ID: 1171124017

View in Genome Browser
Species Human (GRCh38)
Location 20:22586386-22586408
Sequence TGGGACCCCGTGGGAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171124017_1171124021 -7 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124021 20:22586402-22586424 GGTCCCACCTAGCGCGTGGATGG No data
1171124017_1171124022 -6 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124022 20:22586403-22586425 GTCCCACCTAGCGCGTGGATGGG No data
1171124017_1171124028 23 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124028 20:22586432-22586454 TTCATCACTCCACCGAGGGCAGG No data
1171124017_1171124029 24 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124029 20:22586433-22586455 TCATCACTCCACCGAGGGCAGGG No data
1171124017_1171124026 18 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124026 20:22586427-22586449 GCAACTTCATCACTCCACCGAGG No data
1171124017_1171124027 19 Left 1171124017 20:22586386-22586408 CCAGCATTTCCCACGGGGTCCCA No data
Right 1171124027 20:22586428-22586450 CAACTTCATCACTCCACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171124017 Original CRISPR TGGGACCCCGTGGGAAATGC TGG (reversed) Intergenic
No off target data available for this crispr