ID: 1171130807

View in Genome Browser
Species Human (GRCh38)
Location 20:22651674-22651696
Sequence CAGAGCACAGTGGAGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171130803_1171130807 13 Left 1171130803 20:22651638-22651660 CCTATTCAACTTACAGAGCCTGT No data
Right 1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG No data
1171130805_1171130807 -5 Left 1171130805 20:22651656-22651678 CCTGTAAGTTGGCTTAGACAGAG No data
Right 1171130807 20:22651674-22651696 CAGAGCACAGTGGAGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171130807 Original CRISPR CAGAGCACAGTGGAGTTGTC TGG Intergenic
No off target data available for this crispr