ID: 1171133198

View in Genome Browser
Species Human (GRCh38)
Location 20:22674075-22674097
Sequence TATGACATCCTGAAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171133196_1171133198 -9 Left 1171133196 20:22674061-22674083 CCAAATAAAGTTTGTATGACATC No data
Right 1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG No data
1171133195_1171133198 2 Left 1171133195 20:22674050-22674072 CCAGGGCTTCACCAAATAAAGTT No data
Right 1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG No data
1171133189_1171133198 30 Left 1171133189 20:22674022-22674044 CCAGGTGCAGCAGAGGGCAGGGT No data
Right 1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG No data
1171133194_1171133198 3 Left 1171133194 20:22674049-22674071 CCCAGGGCTTCACCAAATAAAGT No data
Right 1171133198 20:22674075-22674097 TATGACATCCTGAAGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171133198 Original CRISPR TATGACATCCTGAAGCTGAA GGG Intergenic
No off target data available for this crispr