ID: 1171139528

View in Genome Browser
Species Human (GRCh38)
Location 20:22728979-22729001
Sequence GCCCATGGCCAAGGGACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171139528_1171139542 24 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139542 20:22729026-22729048 GTGGGTATTAGTTCCCTCACAGG No data
1171139528_1171139539 5 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139539 20:22729007-22729029 GTTGCCTGGTGGTGGTGAGGTGG No data
1171139528_1171139538 2 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139538 20:22729004-22729026 AGGGTTGCCTGGTGGTGGTGAGG No data
1171139528_1171139533 -9 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139533 20:22728993-22729015 GCCATGGGCCAAGGGTTGCCTGG No data
1171139528_1171139540 6 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139540 20:22729008-22729030 TTGCCTGGTGGTGGTGAGGTGGG No data
1171139528_1171139535 -6 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139535 20:22728996-22729018 ATGGGCCAAGGGTTGCCTGGTGG No data
1171139528_1171139536 -3 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139536 20:22728999-22729021 GGCCAAGGGTTGCCTGGTGGTGG No data
1171139528_1171139543 25 Left 1171139528 20:22728979-22729001 CCACTGGTCCCTTGGCCATGGGC No data
Right 1171139543 20:22729027-22729049 TGGGTATTAGTTCCCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171139528 Original CRISPR GCCCATGGCCAAGGGACCAG TGG (reversed) Intergenic
No off target data available for this crispr