ID: 1171140321

View in Genome Browser
Species Human (GRCh38)
Location 20:22735201-22735223
Sequence TAGACTCACCACTAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171140314_1171140321 -9 Left 1171140314 20:22735187-22735209 CCTGCCTGCCTCTGTAGACTCAC No data
Right 1171140321 20:22735201-22735223 TAGACTCACCACTAGGGGCAGGG No data
1171140312_1171140321 11 Left 1171140312 20:22735167-22735189 CCTACCACTGCTCAAGGAGGCCT 0: 10
1: 3314
2: 1459
3: 931
4: 753
Right 1171140321 20:22735201-22735223 TAGACTCACCACTAGGGGCAGGG No data
1171140313_1171140321 7 Left 1171140313 20:22735171-22735193 CCACTGCTCAAGGAGGCCTGCCT 0: 16
1: 3675
2: 1258
3: 422
4: 495
Right 1171140321 20:22735201-22735223 TAGACTCACCACTAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171140321 Original CRISPR TAGACTCACCACTAGGGGCA GGG Intergenic
No off target data available for this crispr