ID: 1171142076

View in Genome Browser
Species Human (GRCh38)
Location 20:22752022-22752044
Sequence CTGGACAGAGGCTCCCTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171142076_1171142081 -9 Left 1171142076 20:22752022-22752044 CCACCAAGGGAGCCTCTGTCCAG No data
Right 1171142081 20:22752036-22752058 TCTGTCCAGGCAGTTTGGTGTGG No data
1171142076_1171142082 -8 Left 1171142076 20:22752022-22752044 CCACCAAGGGAGCCTCTGTCCAG No data
Right 1171142082 20:22752037-22752059 CTGTCCAGGCAGTTTGGTGTGGG No data
1171142076_1171142085 25 Left 1171142076 20:22752022-22752044 CCACCAAGGGAGCCTCTGTCCAG No data
Right 1171142085 20:22752070-22752092 TGCCCCAGAGCGAAAGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171142076 Original CRISPR CTGGACAGAGGCTCCCTTGG TGG (reversed) Intergenic
No off target data available for this crispr