ID: 1171147488

View in Genome Browser
Species Human (GRCh38)
Location 20:22798132-22798154
Sequence CTGGGTTAACCCTGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171147488_1171147494 -4 Left 1171147488 20:22798132-22798154 CCTGCTTCCCAGGGTTAACCCAG No data
Right 1171147494 20:22798151-22798173 CCAGATAGGAGTTAAAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171147488 Original CRISPR CTGGGTTAACCCTGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr