ID: 1171151251

View in Genome Browser
Species Human (GRCh38)
Location 20:22828122-22828144
Sequence CATTCCAAGGAGATGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171151251_1171151257 16 Left 1171151251 20:22828122-22828144 CCCTCCCTCATCTCCTTGGAATG No data
Right 1171151257 20:22828161-22828183 AGATGCAATTCACCTTGTCTGGG No data
1171151251_1171151256 15 Left 1171151251 20:22828122-22828144 CCCTCCCTCATCTCCTTGGAATG No data
Right 1171151256 20:22828160-22828182 AAGATGCAATTCACCTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171151251 Original CRISPR CATTCCAAGGAGATGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr