ID: 1171154264 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:22858056-22858078 |
| Sequence | GATTATGCCCAGGGTGCTAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171154264_1171154269 | 9 | Left | 1171154264 | 20:22858056-22858078 | CCCATAGCACCCTGGGCATAATC | No data | ||
| Right | 1171154269 | 20:22858088-22858110 | CACTCACAAATACCTGTTTGTGG | No data | ||||
| 1171154264_1171154270 | 10 | Left | 1171154264 | 20:22858056-22858078 | CCCATAGCACCCTGGGCATAATC | No data | ||
| Right | 1171154270 | 20:22858089-22858111 | ACTCACAAATACCTGTTTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171154264 | Original CRISPR | GATTATGCCCAGGGTGCTAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||