ID: 1171154264

View in Genome Browser
Species Human (GRCh38)
Location 20:22858056-22858078
Sequence GATTATGCCCAGGGTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171154264_1171154269 9 Left 1171154264 20:22858056-22858078 CCCATAGCACCCTGGGCATAATC No data
Right 1171154269 20:22858088-22858110 CACTCACAAATACCTGTTTGTGG No data
1171154264_1171154270 10 Left 1171154264 20:22858056-22858078 CCCATAGCACCCTGGGCATAATC No data
Right 1171154270 20:22858089-22858111 ACTCACAAATACCTGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171154264 Original CRISPR GATTATGCCCAGGGTGCTAT GGG (reversed) Intergenic
No off target data available for this crispr