ID: 1171159682

View in Genome Browser
Species Human (GRCh38)
Location 20:22909904-22909926
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171159675_1171159682 18 Left 1171159675 20:22909863-22909885 CCAGGAGAAGTATGAGAACTACA No data
Right 1171159682 20:22909904-22909926 AGCAACAAAGGAGGCCTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171159682 Original CRISPR AGCAACAAAGGAGGCCTAAA GGG Intergenic