ID: 1171164329

View in Genome Browser
Species Human (GRCh38)
Location 20:22957171-22957193
Sequence GGCAAAGGGGCAGCCTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171164329_1171164346 27 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164346 20:22957221-22957243 GCTGAGAGGGAGACAGGACTTGG No data
1171164329_1171164342 14 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164342 20:22957208-22957230 TGTCCCTGCAGAGGCTGAGAGGG No data
1171164329_1171164347 28 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164347 20:22957222-22957244 CTGAGAGGGAGACAGGACTTGGG No data
1171164329_1171164348 29 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164348 20:22957223-22957245 TGAGAGGGAGACAGGACTTGGGG No data
1171164329_1171164341 13 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164341 20:22957207-22957229 ATGTCCCTGCAGAGGCTGAGAGG No data
1171164329_1171164340 5 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164340 20:22957199-22957221 GCTGGAAAATGTCCCTGCAGAGG No data
1171164329_1171164345 21 Left 1171164329 20:22957171-22957193 CCCTTCCAGGCTGCCCCTTTGCC No data
Right 1171164345 20:22957215-22957237 GCAGAGGCTGAGAGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171164329 Original CRISPR GGCAAAGGGGCAGCCTGGAA GGG (reversed) Intergenic
No off target data available for this crispr