ID: 1171168549

View in Genome Browser
Species Human (GRCh38)
Location 20:22994746-22994768
Sequence TGGGAGAGGCAGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171168549_1171168559 2 Left 1171168549 20:22994746-22994768 CCCACCCCATCCTGCCTCTCCCA No data
Right 1171168559 20:22994771-22994793 GTGATTCTCTCCATAAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171168549 Original CRISPR TGGGAGAGGCAGGATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr