ID: 1171168998

View in Genome Browser
Species Human (GRCh38)
Location 20:22998867-22998889
Sequence TTCCCACGGCTTCTCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171168998_1171169005 4 Left 1171168998 20:22998867-22998889 CCATTCCCGAGAAGCCGTGGGAA No data
Right 1171169005 20:22998894-22998916 CCCTATGAAATCTATAGATGTGG No data
1171168998_1171169007 17 Left 1171168998 20:22998867-22998889 CCATTCCCGAGAAGCCGTGGGAA No data
Right 1171169007 20:22998907-22998929 ATAGATGTGGAGTCAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171168998 Original CRISPR TTCCCACGGCTTCTCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr