ID: 1171170952

View in Genome Browser
Species Human (GRCh38)
Location 20:23015038-23015060
Sequence GCTCATGGTGTTCCCCATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171170952_1171170957 10 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170957 20:23015071-23015093 CTCCTAAAGCTGCAGAGCCTGGG No data
1171170952_1171170960 12 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170960 20:23015073-23015095 CCTAAAGCTGCAGAGCCTGGGGG No data
1171170952_1171170963 20 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170963 20:23015081-23015103 TGCAGAGCCTGGGGGTGGCAGGG No data
1171170952_1171170961 15 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170961 20:23015076-23015098 AAAGCTGCAGAGCCTGGGGGTGG No data
1171170952_1171170958 11 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170958 20:23015072-23015094 TCCTAAAGCTGCAGAGCCTGGGG No data
1171170952_1171170962 19 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170962 20:23015080-23015102 CTGCAGAGCCTGGGGGTGGCAGG No data
1171170952_1171170956 9 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170956 20:23015070-23015092 GCTCCTAAAGCTGCAGAGCCTGG No data
1171170952_1171170964 23 Left 1171170952 20:23015038-23015060 CCAGGATGGGGAACACCATGAGC No data
Right 1171170964 20:23015084-23015106 AGAGCCTGGGGGTGGCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171170952 Original CRISPR GCTCATGGTGTTCCCCATCC TGG (reversed) Intergenic
No off target data available for this crispr