ID: 1171172052

View in Genome Browser
Species Human (GRCh38)
Location 20:23024139-23024161
Sequence CGGCCTCTTTCTCGATCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171172049_1171172052 29 Left 1171172049 20:23024087-23024109 CCTGTAAACAGGAAGTGTCCTAG 0: 26
1: 22
2: 38
3: 31
4: 99
Right 1171172052 20:23024139-23024161 CGGCCTCTTTCTCGATCTTCAGG No data
1171172050_1171172052 11 Left 1171172050 20:23024105-23024127 CCTAGTATAATGTAACTGCTACA No data
Right 1171172052 20:23024139-23024161 CGGCCTCTTTCTCGATCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171172052 Original CRISPR CGGCCTCTTTCTCGATCTTC AGG Intergenic
No off target data available for this crispr