ID: 1171173732

View in Genome Browser
Species Human (GRCh38)
Location 20:23036080-23036102
Sequence AGGCCGGGTGTGGCCACTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171173732_1171173738 -5 Left 1171173732 20:23036080-23036102 CCTGCAGTGGCCACACCCGGCCT 0: 1
1: 0
2: 0
3: 26
4: 214
Right 1171173738 20:23036098-23036120 GGCCTGGTCGGCAGTCTTCGTGG 0: 1
1: 0
2: 0
3: 7
4: 62
1171173732_1171173740 13 Left 1171173732 20:23036080-23036102 CCTGCAGTGGCCACACCCGGCCT 0: 1
1: 0
2: 0
3: 26
4: 214
Right 1171173740 20:23036116-23036138 CGTGGTCTACACTTTCCTGCTGG 0: 1
1: 0
2: 1
3: 4
4: 61
1171173732_1171173741 14 Left 1171173732 20:23036080-23036102 CCTGCAGTGGCCACACCCGGCCT 0: 1
1: 0
2: 0
3: 26
4: 214
Right 1171173741 20:23036117-23036139 GTGGTCTACACTTTCCTGCTGGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171173732 Original CRISPR AGGCCGGGTGTGGCCACTGC AGG (reversed) Exonic
900212235 1:1461815-1461837 GGGCCGGGTGTGGCAGCTGCAGG - Intronic
900224907 1:1528473-1528495 GGGCCGGGTGTGGCAGCTGGAGG - Intronic
900421280 1:2557011-2557033 TGGCCGGATGTGGGCACTTCTGG + Intronic
900767681 1:4516083-4516105 AGGCCTGGAGTGTTCACTGCCGG - Intergenic
901069865 1:6511729-6511751 AGGCCTGGAGTGGGCACTGCAGG + Intronic
901212250 1:7533278-7533300 AGGCCGGCTGTGCCCTCTGCAGG + Intronic
901474997 1:9483354-9483376 GGGCCGTGTGGGGCCAGTGCAGG - Intergenic
902571927 1:17352525-17352547 AGGCAGGGTGTGGCCAGAGGAGG + Intronic
903588816 1:24438603-24438625 CGGCCAGCTCTGGCCACTGCGGG + Intronic
905302933 1:36997868-36997890 AGGCCTGGTATGGCCACTTCTGG - Intronic
905825665 1:41024250-41024272 AGGCAGGGTGGAGCCACGGCTGG + Intergenic
906099012 1:43244549-43244571 AGGCCTGGTATTGCCACTTCAGG - Intronic
907230047 1:52988967-52988989 TGGCCGTGTGTGGCCCATGCCGG - Intronic
910846407 1:91608922-91608944 GGTCCTCGTGTGGCCACTGCAGG - Intergenic
913681091 1:121187226-121187248 AGGCCGGGTGCGGCGGCGGCTGG - Exonic
914032921 1:143974866-143974888 AGGCCGGGTGCGGCGGCGGCTGG - Intergenic
914156525 1:145093100-145093122 AGGCCGGGTGCGGCGGCGGCTGG + Exonic
914843364 1:151266164-151266186 AAGCTGGGTGTAGGCACTGCAGG + Intronic
920017420 1:202924498-202924520 ATGCCAGGTGTGGCCACTCTGGG + Intronic
920499583 1:206477768-206477790 AAGCCGGCTGGGGCCATTGCAGG + Exonic
921925397 1:220706636-220706658 AGGCCGGGAGTGGCCTCTCCTGG - Intergenic
1062935679 10:1384793-1384815 AGATCTGGTGGGGCCACTGCTGG + Intronic
1067091154 10:43266501-43266523 CGGGCGGGCGTGGGCACTGCGGG - Intronic
1067295136 10:44971344-44971366 AGGCCTGCTGTGGCTGCTGCGGG - Intronic
1067455221 10:46414354-46414376 AGGCCTGGGGTGGCCCCAGCGGG + Intergenic
1067472954 10:46549422-46549444 GGGCCGGAGGGGGCCACTGCGGG - Exonic
1068810139 10:61246100-61246122 AGGCCTAGTGTGGCCACTGATGG - Intergenic
1070752576 10:78972898-78972920 AGCCTGCGTGTGGCCACAGCTGG + Intergenic
1072898722 10:99389028-99389050 AGGTCGGGTGGGGGAACTGCTGG - Intronic
1074138709 10:110651659-110651681 AGCACGGCTGTGGCTACTGCAGG + Intronic
1076293525 10:129366122-129366144 AGGGAGGGTGGGGCCAGTGCAGG + Intergenic
1076325286 10:129616114-129616136 AGGCAGGGTGTGGGCACCACAGG + Intronic
1076431568 10:130407474-130407496 AGGCCAGGTGTGGTGACTGAAGG + Intergenic
1076509845 10:131005445-131005467 GGATTGGGTGTGGCCACTGCAGG + Intergenic
1076586997 10:131556122-131556144 ACGCCAGGTGTGGGAACTGCAGG + Intergenic
1076679319 10:132163526-132163548 ATGAGGGGTGTGGCCACTGGAGG - Intronic
1076715050 10:132359479-132359501 CGGCCTTGGGTGGCCACTGCTGG + Intronic
1076783087 10:132735224-132735246 AGGCTGGGTGTGGCCTTTTCCGG - Intronic
1076829471 10:132986714-132986736 AGGGTGGGTGTGGCCGATGCTGG + Intergenic
1077056520 11:596669-596691 AGGCCAGGTGAGGTCACAGCGGG - Intronic
1077111462 11:863996-864018 AGCCCAGCTGTGGCCCCTGCTGG + Intronic
1077329559 11:1978025-1978047 AGGCCAGCTGTGGCCTCTGGAGG + Intronic
1077361858 11:2144385-2144407 AGGCCGGAGGTGGCCACCGGGGG - Intronic
1077444597 11:2585097-2585119 AGGCCAGGTATGGTCAGTGCTGG - Intronic
1078524225 11:12088386-12088408 TGGCCTGGGGTGGCCTCTGCTGG - Intergenic
1080854992 11:36104340-36104362 AGCCAGGGTGTGGCCACTCCTGG + Intronic
1081739859 11:45431195-45431217 AGACAGGGTCTGGCCCCTGCAGG - Intergenic
1081960730 11:47134738-47134760 AGGAAGTGAGTGGCCACTGCAGG + Intronic
1083610150 11:64000580-64000602 GGGCCGGGTGCGCCCCCTGCCGG - Intronic
1083647876 11:64183620-64183642 AGGCCTGGAAAGGCCACTGCTGG + Intergenic
1083719936 11:64599081-64599103 AGGCCGGGTGGGCTCACTGAGGG + Intronic
1084118647 11:67056431-67056453 AGGCCTGGTGGGGCCAGTGAAGG + Intergenic
1084372166 11:68751320-68751342 GGGCCGGGTCGGGCCCCTGCGGG - Intronic
1084557462 11:69883527-69883549 ATGCTGGGTGTGGTCTCTGCGGG + Intergenic
1084698715 11:70771741-70771763 TGGCCGTGTGTGGCCACAGTGGG - Intronic
1089777024 11:120844968-120844990 AGGCATGGTGTGGCCAGTGAAGG - Intronic
1090688209 11:129148923-129148945 AGGCTTGCTGTGGCCACTGTAGG - Intronic
1091268257 11:134287667-134287689 AGGGCCTGTGTGGTCACTGCTGG + Intronic
1202812538 11_KI270721v1_random:33204-33226 AGGCCAGCTGTGGCCTCTGGAGG + Intergenic
1091832213 12:3557822-3557844 AGGCAGTGTGTGGGCACAGCAGG + Intronic
1092868761 12:12787176-12787198 GGGCTGGGGGTGGCCACAGCCGG + Exonic
1096477809 12:51919109-51919131 AGACCCGGTGAGGCCTCTGCTGG + Exonic
1099004388 12:77218778-77218800 AGGCAGTGTGGAGCCACTGCAGG - Intergenic
1102146981 12:110661512-110661534 AGGCCGGGCCAGGCCACTGCAGG + Intronic
1102721323 12:115018890-115018912 TGGCCGGTTCTGCCCACTGCAGG - Intergenic
1103576657 12:121882459-121882481 GGGCTGTCTGTGGCCACTGCAGG + Intergenic
1104815797 12:131644734-131644756 AGGGCAGGTGTAGCCCCTGCAGG + Intergenic
1104842921 12:131833188-131833210 AGGCTGGGGGTGGTCCCTGCTGG - Intronic
1109065050 13:57676373-57676395 AGACAGGGTGAGGTCACTGCAGG + Intronic
1115364514 14:32542716-32542738 TGGCCGCGTGTGGCCAGTGAGGG + Intronic
1115546934 14:34472299-34472321 AGGCCGGGTGCGGCCTCAGCTGG - Intergenic
1115555664 14:34543294-34543316 AAGACAGGAGTGGCCACTGCAGG + Intergenic
1115558244 14:34559799-34559821 AAGACAGGAGTGGCCACTGCAGG - Intergenic
1120202592 14:81553938-81553960 AGGCCTGGTTTGGGCACAGCAGG - Intergenic
1120993303 14:90397236-90397258 AGGTCGGGAGTGGCAAATGCCGG + Intronic
1121562201 14:94884182-94884204 AGGCTGGCTGGGGCCACTTCTGG + Intergenic
1122577353 14:102750757-102750779 AGGCTGGCTGGGGCCACTGCAGG + Intergenic
1122865548 14:104602420-104602442 AGGCCAGGTGGGGCCACAGTTGG - Intronic
1123106062 14:105841607-105841629 TGGCCAGGTGTGGCCAGTGGAGG + Intergenic
1128330458 15:66752213-66752235 AGGACGGCTGAGGCCAGTGCTGG + Intronic
1128560811 15:68666658-68666680 AGGGCGGCTGTGGGCACTGGGGG + Intronic
1128833601 15:70791303-70791325 AAGCCTGGGGTGGGCACTGCAGG - Intergenic
1129191558 15:73940814-73940836 AGGCCAGGTGGGGCCAGTGAGGG - Intronic
1129548045 15:76418780-76418802 AGGCCAGATGTGGGCACAGCAGG - Intronic
1129771097 15:78204093-78204115 AGGCCGGGAGTGGCAGCTGCAGG - Intronic
1132298099 15:100758761-100758783 AGGCCGGGTGTGGCAGCTCATGG - Intergenic
1132553350 16:562205-562227 TGGCTGAGTGTGGCCGCTGCAGG + Intronic
1132678445 16:1130246-1130268 GGGACGGCTGTGGCCACCGCAGG - Intergenic
1133311004 16:4847023-4847045 AGGCCGAGGGTGGCCACGTCGGG - Intronic
1134553166 16:15147486-15147508 GGGCCCGGCGTGGCCACCGCGGG + Intergenic
1135048334 16:19172159-19172181 AGGCGGGGTGGGGCCACAACAGG + Intronic
1137521476 16:49199080-49199102 AGCCCAGGTGCGGCCACTGAGGG - Intergenic
1138413892 16:56860266-56860288 AGGAGGGGTGTGGTCATTGCAGG - Intergenic
1141070858 16:80953277-80953299 AGGCCAGGAGTGGCCTCTGATGG - Intergenic
1141461220 16:84179803-84179825 AGGCCTGGTGTGGGCGCTGAGGG + Exonic
1142118389 16:88373242-88373264 AGGGTGACTGTGGCCACTGCAGG - Intergenic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142671259 17:1488338-1488360 AGGCCGGGGGTTGCCAGTGCTGG - Intronic
1143612331 17:8025942-8025964 AGGCTGGCTGTGCCCACTGGAGG - Intergenic
1143632076 17:8145217-8145239 TGGCAGGGAGTGGCCACTGGAGG - Intronic
1144210658 17:13012373-13012395 AGGCTGGGGGTGGCTACAGCAGG + Intronic
1149521697 17:57322827-57322849 AGCCCAGCTGTGGCAACTGCAGG + Intronic
1149568981 17:57658919-57658941 GGGCTGGGTGGGGGCACTGCAGG + Intronic
1153955594 18:10093079-10093101 AGGACAGCTGAGGCCACTGCAGG + Intergenic
1154303874 18:13217427-13217449 AGGCCGGGGGTGGGCAGTGGGGG - Intergenic
1154415379 18:14173076-14173098 AGGCATGGTATGGCCAGTGCAGG + Intergenic
1156454224 18:37283826-37283848 AGGCAAGGGGTGGGCACTGCGGG + Intronic
1157433662 18:47651238-47651260 GGGCCAGGTGTGGGCCCTGCAGG + Intergenic
1160856474 19:1220178-1220200 CGGACGAGGGTGGCCACTGCAGG + Intronic
1161318691 19:3631275-3631297 AGGACTGGTGTGGCCTCTGGGGG + Exonic
1161572483 19:5038191-5038213 AGTCCTGGGGTGGGCACTGCAGG - Intronic
1162395582 19:10416662-10416684 ATGCCGGGGTTGGCCACTGGGGG - Intronic
1163370204 19:16897280-16897302 AGGGCGGGTGTGTTCAGTGCGGG - Intronic
1164985361 19:32644502-32644524 AGGCCGGCTGAAGCCTCTGCTGG + Intronic
1166232264 19:41431806-41431828 AGGGCCGCTGTGCCCACTGCAGG - Intronic
1166347125 19:42173528-42173550 TGGCCTGGAGTGGCCACTGACGG + Intronic
1166960647 19:46494158-46494180 AGGCTGGGCGTGGCCTCTTCGGG - Exonic
1168328944 19:55554907-55554929 AGGCCGAGGGTGTGCACTGCCGG - Intergenic
1168460165 19:56547920-56547942 AGGTAGGGTGAGGCCACTGCTGG + Intronic
925867892 2:8244855-8244877 AGGAGGGAGGTGGCCACTGCTGG - Intergenic
929465851 2:42143138-42143160 AGGCCCCCTGTAGCCACTGCAGG + Intergenic
930152153 2:48069956-48069978 GGCCAGGGTGTGGCCACTGAGGG + Intergenic
937457718 2:122057499-122057521 AGCCCAGGTCTGGCCACTTCTGG + Intergenic
938406374 2:131035313-131035335 AGGCCGCGGGTGGCAACGGCTGG - Intronic
938696055 2:133836671-133836693 AGGCTGCCTGTGGCCACTGGTGG - Intergenic
938900154 2:135792718-135792740 AGGCTTGCTGTGGCCACTGTGGG - Intronic
939742141 2:145921736-145921758 AGGCCATGTGTGGACACTGGAGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
943637230 2:190319631-190319653 GGGCCGGGGGTGGAGACTGCTGG - Intronic
946465526 2:219908720-219908742 AGGCCTGGTGAGGGCAGTGCAGG + Intergenic
947462240 2:230313541-230313563 AACCAGGGTGTGGCCACAGCTGG - Intergenic
947564558 2:231185712-231185734 GGGGCGGGTGAGGCCACAGCTGG + Intergenic
947574356 2:231260896-231260918 AAGCCGGGTGGGGGCACTGGAGG - Intronic
947791578 2:232872053-232872075 AGGCCTGGTCTGGCCCCTGCGGG - Intronic
948177362 2:235954661-235954683 AGGCGGGGTGTGGAGGCTGCTGG - Intronic
1168788841 20:562620-562642 AGGCCAGGGATGGCCAATGCCGG - Intergenic
1169391444 20:5194484-5194506 AGGCCAGGTAAGGCCACTGCTGG - Exonic
1170598841 20:17825406-17825428 CGGCTGGGTGTGGCCAATGGGGG - Intergenic
1171173732 20:23036080-23036102 AGGCCGGGTGTGGCCACTGCAGG - Exonic
1171194337 20:23185866-23185888 AGGCCGGGTGTTGCCTCACCTGG - Intergenic
1172619246 20:36308266-36308288 AGGCCTGGTGAGGCCTGTGCTGG + Intronic
1173746871 20:45444407-45444429 AGGAAGGCTGTGGGCACTGCAGG - Intergenic
1174140922 20:48413089-48413111 AGACAGGGTGTTGCCACTGTGGG - Intergenic
1175874802 20:62224294-62224316 ACCTCGGCTGTGGCCACTGCAGG - Intergenic
1176407620 21:6430071-6430093 AGGCTGGCTATGGCCACTGCTGG - Intergenic
1176857942 21:13986188-13986210 AGGCATGGTATGGCCAGTGCAGG - Intergenic
1176866647 21:14058007-14058029 AGGCATGGTATGGCCAGTGCAGG + Intergenic
1178808141 21:35856565-35856587 AGGCCTGGGGTGGTCACTGGAGG + Intronic
1178808436 21:35859152-35859174 AGGCCTGGGGTGGTCACTGGAGG + Intronic
1178992606 21:37367642-37367664 AGGCCGGGCGGGGCCGCGGCCGG - Intronic
1179682642 21:43035060-43035082 AGGTCGGGTCTGGCACCTGCAGG + Intergenic
1179683111 21:43038402-43038424 AGGCTGGCTATGGCCACTGCTGG - Intergenic
1179792381 21:43763007-43763029 AGGCCCAGAGTAGCCACTGCAGG - Intergenic
1180095719 21:45554519-45554541 TGGCCGGGTCTGGCCACCGCGGG + Intergenic
1181495283 22:23284123-23284145 AGTCAGGGTGGGGTCACTGCTGG - Intronic
1182222908 22:28772906-28772928 AGGCCGGCTGCGGCGGCTGCAGG - Exonic
1183281702 22:36935862-36935884 GGGCCAGGTGTGGGCACTCCAGG - Intronic
1183588542 22:38767117-38767139 AGGCCAGGGATGGCCACTGCTGG + Intronic
1183912586 22:41091227-41091249 AGGCAGGGTGTACCCACTGCCGG - Intergenic
1184310396 22:43637536-43637558 AGGCTGTGTGTGGCTAGTGCCGG + Intronic
950524244 3:13514234-13514256 AGGCTGGGTGTGGCCGCTCCAGG + Intergenic
950566412 3:13772279-13772301 AGGGCAGGGGTGGCCACTGCTGG + Intergenic
952867502 3:37863596-37863618 AGGCCGGAGCTGGCCACAGCCGG + Intronic
953443084 3:42936494-42936516 GAGGCGGGTGTGGCTACTGCTGG + Intronic
953879016 3:46682003-46682025 AGGCTGGCTGGGGCTACTGCTGG - Intronic
954634793 3:52065596-52065618 AGGCTGGGTGGGGCCAGGGCAGG - Intergenic
960525677 3:118707018-118707040 AGGCCTGGAATGGCCGCTGCTGG - Intergenic
968356492 3:198111613-198111635 AGCCCAGGTGTGGGCACAGCAGG + Intergenic
968503913 4:963327-963349 AGGTGGGGTGTCCCCACTGCTGG + Intronic
968649251 4:1753927-1753949 CGGCTGGGGGTGGCCACGGCTGG - Intergenic
968899893 4:3426119-3426141 AGGGCGAGTGGGGCCAGTGCAGG + Intronic
968899913 4:3426172-3426194 AGGGCGAGTGGGGCCAGTGCAGG + Intronic
968899933 4:3426225-3426247 AGGGCGAGTGGGGCCAGTGCAGG + Intronic
970670927 4:18396010-18396032 AGGCCTGGTGTCTCCTCTGCTGG - Intergenic
976562785 4:86521465-86521487 AGGCTTGTTGTGGCCACTGTCGG + Intronic
976733325 4:88285292-88285314 AGGCATGGTGTGGACACTGGAGG + Intergenic
977206057 4:94166284-94166306 AGGCCGGGTGTGGCCAGGTGCGG - Intergenic
982572579 4:157068735-157068757 AGGCCAGGTGTGGTCACTCACGG + Intergenic
984728640 4:183045135-183045157 AGGGTGGGTGTGGGCTCTGCAGG + Intergenic
985187447 4:187332834-187332856 AGGGCTGGAGTGGCCACTGACGG - Intergenic
985555370 5:555456-555478 GGGCCTGATGTGCCCACTGCTGG - Intergenic
985770794 5:1809396-1809418 TGGCTGGGTGTGTTCACTGCCGG + Intronic
985770807 5:1809457-1809479 TGGCTGGGTGTGTTCACTGCTGG + Intronic
997425223 5:133798664-133798686 TGGCTGGGTATGGCCACCGCAGG - Intergenic
997795178 5:136802561-136802583 ATGCCAGGTGAGGGCACTGCTGG + Intergenic
997952495 5:138253307-138253329 AGGTAGGGTGTGGCCAGTCCTGG + Exonic
998758605 5:145407435-145407457 AGGCTTGTTGTGGCCACTGTGGG - Intergenic
999269347 5:150287456-150287478 AGCCCTGGTGTGGCCATGGCAGG - Intronic
1000083351 5:157867918-157867940 GGGCCCTCTGTGGCCACTGCTGG + Intergenic
1001437049 5:171707591-171707613 AGGCTGGGTGTGGCAAGAGCAGG + Intergenic
1002643455 5:180641373-180641395 AGGCCCAGGGTGGCCACCGCAGG - Intronic
1003212437 6:4079390-4079412 AGGCCGGGGGCGGCCCCTTCAGG - Exonic
1003315867 6:5011426-5011448 AGGCCGGTACTGGCCAGTGCAGG + Intergenic
1003642411 6:7887179-7887201 AGGCCTGGTGTGGCCCCACCAGG + Intronic
1011628647 6:89303259-89303281 AGGACGGGTGTAAACACTGCAGG - Intronic
1018853419 6:167657853-167657875 AGGCCAGGTGAGGACACAGCAGG + Intergenic
1019608770 7:1924556-1924578 AGGTGGGGTGAGGACACTGCTGG + Intronic
1022214384 7:28243773-28243795 AGGCCAGGTGAGGCCATAGCAGG + Intergenic
1023623647 7:42096057-42096079 AGCCAGGGTGTGTGCACTGCAGG + Intronic
1024791000 7:52964791-52964813 AGGCCTCCTCTGGCCACTGCTGG + Intergenic
1026642636 7:72140594-72140616 AGGCAGGGTGTGGCCAGTCTGGG + Intronic
1027674804 7:81143848-81143870 AGGCAGGCAGTGGTCACTGCAGG + Intergenic
1029972046 7:104799497-104799519 AGGCAAGGTGTGGGCAATGCTGG - Intronic
1031799399 7:126223592-126223614 GGGCTTGCTGTGGCCACTGCTGG + Intergenic
1032783730 7:135184623-135184645 AGGCAGGGTGTGGACACAGCTGG + Exonic
1034088780 7:148345066-148345088 AGCCCGAGTGTGGCCAGTGGAGG + Intronic
1034426471 7:151016724-151016746 AGGCTGGCTGTGGCCGCAGCTGG + Exonic
1037334785 8:17781681-17781703 AAGACAGGTGTGGCCAGTGCAGG - Intronic
1037608915 8:20459830-20459852 TAGCCGCGTGTGTCCACTGCTGG - Intergenic
1037803813 8:22048877-22048899 CGGCCGGGCGTGGCCACGGCAGG + Intergenic
1037825796 8:22159920-22159942 AGGGCAGGGGTGGGCACTGCAGG + Intronic
1037982101 8:23261648-23261670 AGGCAGGGAGTGGGGACTGCAGG - Exonic
1039957679 8:42219757-42219779 AGGCCAGGTGTGGTGACTCCCGG + Intergenic
1041662546 8:60413672-60413694 AGCCCGTGTGTGGGAACTGCAGG - Intergenic
1042487217 8:69359950-69359972 AGACCTGGAGTGGCCACAGCTGG - Intergenic
1042834683 8:73068791-73068813 AGGCCGGCTTTGGCCTCTACGGG - Intronic
1048331629 8:133474656-133474678 AGCCCGAGGGTGGCCTCTGCTGG - Intronic
1049060749 8:140274320-140274342 GGGCCGGGTGTGCCCAGAGCAGG - Intronic
1049378634 8:142301277-142301299 AGGGCAGGTGGGGGCACTGCGGG - Intronic
1049378656 8:142301339-142301361 AGGGCAGGTGGGGGCACTGCGGG - Intronic
1049433214 8:142574805-142574827 ACGCAGGGTGTGGACACGGCTGG - Intergenic
1049509661 8:143021100-143021122 AGGCCGGGTGAGCCCTCTGCTGG - Intronic
1049813365 8:144586298-144586320 AGTCCTGTTGTGGCCACTGCTGG - Intronic
1054273418 9:63048441-63048463 AGGCATGGTATGGCCAGTGCAGG + Intergenic
1054982676 9:71224055-71224077 AGGCCTGCTGTAGCCACTACTGG - Intronic
1056967774 9:91179040-91179062 AGGCGGGGTCTCCCCACTGCAGG - Intergenic
1057820252 9:98324663-98324685 ATGGCTGCTGTGGCCACTGCTGG + Intronic
1057855720 9:98599432-98599454 AGGCCTGGTATGTCCATTGCAGG - Intronic
1059352095 9:113672686-113672708 GGGCCAGTTGAGGCCACTGCAGG - Intergenic
1060658474 9:125388746-125388768 AGGGCAGGTGAGGCCACTACTGG + Intergenic
1061594827 9:131622027-131622049 AGGCCGGGGGAGGCCACATCAGG + Intronic
1062044771 9:134419919-134419941 TGGCCGGCTGTGCACACTGCAGG + Intronic
1062519518 9:136951878-136951900 TGCCCGGGTTTGGCCACAGCTGG + Intronic
1062537070 9:137025726-137025748 AGGCCGGGTGTGGGCGGGGCTGG - Intronic
1186078203 X:5903302-5903324 AGGTCGGCGGTGGCCACGGCGGG + Exonic
1188666546 X:32828339-32828361 TGGCCAGGTGTGGTGACTGCTGG - Intronic
1191631401 X:63325773-63325795 AGCCTGGCTATGGCCACTGCTGG + Intergenic
1194268558 X:91782223-91782245 GAGGCGGGGGTGGCCACTGCTGG + Intronic
1195469901 X:105219697-105219719 TGGCCAGGCCTGGCCACTGCCGG - Exonic
1200585759 Y:5003137-5003159 GAGGCGGGGGTGGCCACTGCTGG + Intronic
1201517139 Y:14830272-14830294 AGGTCGGCGGTGGCCACGGCGGG - Exonic