ID: 1171176201 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:23052076-23052098 |
| Sequence | ATATGAGGAGGTGCAGATGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171176195_1171176201 | 20 | Left | 1171176195 | 20:23052033-23052055 | CCACTAAGAACTCAGTGATGTCT | No data | ||
| Right | 1171176201 | 20:23052076-23052098 | ATATGAGGAGGTGCAGATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171176201 | Original CRISPR | ATATGAGGAGGTGCAGATGT TGG | Intergenic | ||