ID: 1171176201

View in Genome Browser
Species Human (GRCh38)
Location 20:23052076-23052098
Sequence ATATGAGGAGGTGCAGATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171176195_1171176201 20 Left 1171176195 20:23052033-23052055 CCACTAAGAACTCAGTGATGTCT No data
Right 1171176201 20:23052076-23052098 ATATGAGGAGGTGCAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171176201 Original CRISPR ATATGAGGAGGTGCAGATGT TGG Intergenic