ID: 1171176911

View in Genome Browser
Species Human (GRCh38)
Location 20:23058347-23058369
Sequence GGCTCTCTTGCTATTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171176911_1171176914 -4 Left 1171176911 20:23058347-23058369 CCACAGAAAATAGCAAGAGAGCC No data
Right 1171176914 20:23058366-23058388 AGCCCCAGAGGCTGCCTGCTGGG No data
1171176911_1171176919 25 Left 1171176911 20:23058347-23058369 CCACAGAAAATAGCAAGAGAGCC No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176911_1171176920 29 Left 1171176911 20:23058347-23058369 CCACAGAAAATAGCAAGAGAGCC No data
Right 1171176920 20:23058399-23058421 TTCTGAAACATGTATCTGGCTGG No data
1171176911_1171176913 -5 Left 1171176911 20:23058347-23058369 CCACAGAAAATAGCAAGAGAGCC No data
Right 1171176913 20:23058365-23058387 GAGCCCCAGAGGCTGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171176911 Original CRISPR GGCTCTCTTGCTATTTTCTG TGG (reversed) Intergenic
No off target data available for this crispr