ID: 1171176917

View in Genome Browser
Species Human (GRCh38)
Location 20:23058370-23058392
Sequence ATTGCCCAGCAGGCAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171176917_1171176921 12 Left 1171176917 20:23058370-23058392 CCAGAGGCTGCCTGCTGGGCAAT No data
Right 1171176921 20:23058405-23058427 AACATGTATCTGGCTGGACCTGG No data
1171176917_1171176920 6 Left 1171176917 20:23058370-23058392 CCAGAGGCTGCCTGCTGGGCAAT No data
Right 1171176920 20:23058399-23058421 TTCTGAAACATGTATCTGGCTGG No data
1171176917_1171176919 2 Left 1171176917 20:23058370-23058392 CCAGAGGCTGCCTGCTGGGCAAT No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176917_1171176922 27 Left 1171176917 20:23058370-23058392 CCAGAGGCTGCCTGCTGGGCAAT No data
Right 1171176922 20:23058420-23058442 GGACCTGGTAATCTCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171176917 Original CRISPR ATTGCCCAGCAGGCAGCCTC TGG (reversed) Intergenic
No off target data available for this crispr