ID: 1171176918

View in Genome Browser
Species Human (GRCh38)
Location 20:23058380-23058402
Sequence AGAAAGAGACATTGCCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171176918_1171176919 -8 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176918_1171176921 2 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176921 20:23058405-23058427 AACATGTATCTGGCTGGACCTGG No data
1171176918_1171176922 17 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176922 20:23058420-23058442 GGACCTGGTAATCTCTGCTCAGG No data
1171176918_1171176924 25 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176924 20:23058428-23058450 TAATCTCTGCTCAGGCCAATAGG No data
1171176918_1171176920 -4 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176920 20:23058399-23058421 TTCTGAAACATGTATCTGGCTGG No data
1171176918_1171176925 28 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176925 20:23058431-23058453 TCTCTGCTCAGGCCAATAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171176918 Original CRISPR AGAAAGAGACATTGCCCAGC AGG (reversed) Intergenic
No off target data available for this crispr