ID: 1171176919

View in Genome Browser
Species Human (GRCh38)
Location 20:23058395-23058417
Sequence CTCTTTCTGAAACATGTATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171176918_1171176919 -8 Left 1171176918 20:23058380-23058402 CCTGCTGGGCAATGTCTCTTTCT No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176916_1171176919 3 Left 1171176916 20:23058369-23058391 CCCAGAGGCTGCCTGCTGGGCAA No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176915_1171176919 4 Left 1171176915 20:23058368-23058390 CCCCAGAGGCTGCCTGCTGGGCA No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176911_1171176919 25 Left 1171176911 20:23058347-23058369 CCACAGAAAATAGCAAGAGAGCC No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data
1171176917_1171176919 2 Left 1171176917 20:23058370-23058392 CCAGAGGCTGCCTGCTGGGCAAT No data
Right 1171176919 20:23058395-23058417 CTCTTTCTGAAACATGTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171176919 Original CRISPR CTCTTTCTGAAACATGTATC TGG Intergenic
No off target data available for this crispr