ID: 1171178557

View in Genome Browser
Species Human (GRCh38)
Location 20:23074374-23074396
Sequence GTGGCCTTCCACACTTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171178557_1171178564 11 Left 1171178557 20:23074374-23074396 CCATCCTAAGTGTGGAAGGCCAC No data
Right 1171178564 20:23074408-23074430 GTGTGGTCATCTGGAAGTGCTGG No data
1171178557_1171178565 12 Left 1171178557 20:23074374-23074396 CCATCCTAAGTGTGGAAGGCCAC No data
Right 1171178565 20:23074409-23074431 TGTGGTCATCTGGAAGTGCTGGG No data
1171178557_1171178561 2 Left 1171178557 20:23074374-23074396 CCATCCTAAGTGTGGAAGGCCAC No data
Right 1171178561 20:23074399-23074421 TGCCCACATGTGTGGTCATCTGG No data
1171178557_1171178559 -6 Left 1171178557 20:23074374-23074396 CCATCCTAAGTGTGGAAGGCCAC No data
Right 1171178559 20:23074391-23074413 GGCCACTTTGCCCACATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171178557 Original CRISPR GTGGCCTTCCACACTTAGGA TGG (reversed) Intergenic
No off target data available for this crispr