ID: 1171178725

View in Genome Browser
Species Human (GRCh38)
Location 20:23075451-23075473
Sequence TGAGCTCTTCCCAGCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171178725_1171178731 2 Left 1171178725 20:23075451-23075473 CCTCCTGTGCTGGGAAGAGCTCA No data
Right 1171178731 20:23075476-23075498 TAGTGCAGGCGGGACCAGAAAGG No data
1171178725_1171178728 -9 Left 1171178725 20:23075451-23075473 CCTCCTGTGCTGGGAAGAGCTCA No data
Right 1171178728 20:23075465-23075487 AAGAGCTCACCTAGTGCAGGCGG No data
1171178725_1171178729 -8 Left 1171178725 20:23075451-23075473 CCTCCTGTGCTGGGAAGAGCTCA No data
Right 1171178729 20:23075466-23075488 AGAGCTCACCTAGTGCAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171178725 Original CRISPR TGAGCTCTTCCCAGCACAGG AGG (reversed) Intergenic
No off target data available for this crispr