ID: 1171179347

View in Genome Browser
Species Human (GRCh38)
Location 20:23081199-23081221
Sequence GTTCAGCAGCAGAACAAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171179347_1171179353 25 Left 1171179347 20:23081199-23081221 CCTGGCTTGTTCTGCTGCTGAAC 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1171179353 20:23081247-23081269 TCTAGCGAGAAGTTAGCAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 69
1171179347_1171179355 30 Left 1171179347 20:23081199-23081221 CCTGGCTTGTTCTGCTGCTGAAC 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1171179355 20:23081252-23081274 CGAGAAGTTAGCAGGTGGCAGGG 0: 1
1: 0
2: 3
3: 12
4: 132
1171179347_1171179352 22 Left 1171179347 20:23081199-23081221 CCTGGCTTGTTCTGCTGCTGAAC 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1171179352 20:23081244-23081266 GTGTCTAGCGAGAAGTTAGCAGG 0: 1
1: 0
2: 0
3: 5
4: 53
1171179347_1171179354 29 Left 1171179347 20:23081199-23081221 CCTGGCTTGTTCTGCTGCTGAAC 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1171179354 20:23081251-23081273 GCGAGAAGTTAGCAGGTGGCAGG 0: 1
1: 0
2: 2
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171179347 Original CRISPR GTTCAGCAGCAGAACAAGCC AGG (reversed) Exonic
900031720 1:377642-377664 GTTCAGCAGCAGGACTGGCTAGG - Intergenic
900052267 1:605833-605855 GTTCAGCAGCAGGACTGGCTAGG - Intergenic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900938902 1:5784984-5785006 TTTCAGGGGCAGAACATGCCTGG + Intergenic
901454629 1:9355995-9356017 GTCCAGTAGCAGATCCAGCCGGG - Exonic
901967174 1:12878079-12878101 GGTCATCAGGAGAACAAGCAAGG + Intronic
901982574 1:13048343-13048365 GGTCATCAGGAGAACAAGCAAGG + Intronic
901999513 1:13180576-13180598 GGTCATCAGGAGAACAAGCAAGG - Intergenic
902010201 1:13264548-13264570 GGTCATCAGGAGAACAAGCAAGG - Intergenic
902017991 1:13323707-13323729 GGTCATCAGGAGAACAAGCAAGG - Intergenic
904038528 1:27571448-27571470 GGGCAGGAGCAGAACAAGTCAGG + Intronic
908476869 1:64497610-64497632 ATTTACCAGGAGAACAAGCCAGG - Intronic
908553037 1:65229095-65229117 GGTCACCAGCAGCAGAAGCCTGG - Exonic
909612340 1:77565441-77565463 GTTCAGCAGCTGAACATTCCTGG - Exonic
912027264 1:105192753-105192775 TTTTATAAGCAGAACAAGCCAGG - Intergenic
912378100 1:109229394-109229416 GTTCTGCAGATGAACAGGCCAGG - Exonic
912520145 1:110239608-110239630 GTTCAGCAGCTGCTCATGCCAGG - Intronic
912693723 1:111824277-111824299 GGTCAACACCAGACCAAGCCTGG - Intronic
915122788 1:153641886-153641908 GTTCAAAAGCAGTACAATCCAGG + Intronic
917662206 1:177187677-177187699 GTTCAAGAGCAGAACAAGAGCGG - Intronic
919780598 1:201218434-201218456 GTTCTGAAGGAGACCAAGCCTGG - Intronic
920530736 1:206700389-206700411 GTGCAGCAGCAAAAAATGCCAGG - Intronic
921162639 1:212483985-212484007 GTTCAGCGGCAGGGCAGGCCTGG + Intergenic
922043797 1:221923602-221923624 GTTCTGGGGCAGAACAAGACTGG + Intergenic
922900320 1:229131411-229131433 GTTTGACAGCAGAAGAAGCCAGG - Intergenic
922926455 1:229350938-229350960 GATCAGCATGATAACAAGCCTGG - Intergenic
1064922715 10:20535921-20535943 GTTCAGCTGCACAACTAGTCAGG - Intergenic
1068472669 10:57484780-57484802 GTTCAGCATCAGAACCAGCCAGG + Intergenic
1068476242 10:57530237-57530259 TTTGAGCAGCAGCACTAGCCTGG - Intergenic
1069700751 10:70423444-70423466 GTTGAGCAGCATAATAATCCCGG + Exonic
1071508257 10:86245838-86245860 GGTCAGCAGAAGAAGAAGGCTGG + Intronic
1072084351 10:92064049-92064071 GTTAAGCAGCACATCAAGCAAGG + Intronic
1072907093 10:99464520-99464542 GGTCAGGAGCAAGACAAGCCTGG - Intergenic
1073555778 10:104449562-104449584 ATTCAGCAGCATCACAACCCTGG + Intronic
1074902153 10:117827076-117827098 CTTCTCCAGCAGACCAAGCCAGG - Intergenic
1075719404 10:124576132-124576154 CCTCAGCAGCTGATCAAGCCCGG - Intronic
1077415172 11:2421385-2421407 GCTCAGCAGCAGAACTGGCTGGG + Intronic
1085015953 11:73174150-73174172 GTCCAGGAGCAGACCAACCCAGG + Intergenic
1085755437 11:79197768-79197790 GTTCAGGAGGAGAGAAAGCCAGG - Intronic
1087104408 11:94395775-94395797 GTTCAGACGGAAAACAAGCCAGG - Intronic
1087584789 11:100105178-100105200 CCTCAGCAGCAGAATAACCCTGG - Intronic
1087901178 11:103643006-103643028 GTTCATCAGCATAACAAAGCTGG + Intergenic
1090638533 11:128709624-128709646 CTTTATCAGCAGCACAAGCCTGG - Intronic
1090674797 11:128981434-128981456 GTTCAGCGGCAGAATCAGCATGG - Exonic
1090904738 11:131065406-131065428 GTACAGCAGGAGAACAAGTTTGG - Intergenic
1093763841 12:22939989-22940011 GTGCAGCAGCAGCACAATCTTGG + Intergenic
1096109374 12:49020104-49020126 GTTCAACTGCAGCACAAGCTTGG + Exonic
1096420436 12:51452630-51452652 GTTCACCTGCAGAAGAAGTCTGG - Intronic
1098049625 12:66439795-66439817 GTTCAACAGAAGAACTAGTCAGG - Intronic
1101428907 12:104610678-104610700 GGTCAGTTTCAGAACAAGCCAGG - Intronic
1102781452 12:115569532-115569554 GATTAGCTGCAGACCAAGCCTGG + Intergenic
1105822942 13:24096155-24096177 GTTTAGCTCCAGAACAAGTCAGG - Intronic
1106079246 13:26486933-26486955 GGCCACCACCAGAACAAGCCAGG - Intergenic
1106765032 13:32905130-32905152 GTTGAGCAGCAGACAAATCCTGG + Intergenic
1112189573 13:97163313-97163335 GTCCAGCAGCTAAAGAAGCCAGG + Intergenic
1113708039 13:112446767-112446789 TTGGACCAGCAGAACAAGCCTGG - Intergenic
1117070480 14:52051481-52051503 TTCCATCAGCAGAAAAAGCCAGG + Intronic
1118749316 14:68794955-68794977 GGGCAGCAGCAGAACAAGCGAGG - Intronic
1121665784 14:95671086-95671108 GTCCAAGAGCAGAACAAGCCTGG - Intergenic
1124555309 15:30719604-30719626 GTTCAACAGCATCACCAGCCAGG + Intronic
1124675952 15:31686090-31686112 GTTCAACAGCATCACCAGCCAGG - Intronic
1124798245 15:32803774-32803796 GTTCAGGAGCAGAGCAATGCAGG + Intronic
1131344823 15:91636907-91636929 GTTCAGCAGCAGCCCCAGCCAGG + Intergenic
1132559395 16:586469-586491 GGTCACCAGCAGACCCAGCCAGG - Intergenic
1133265183 16:4579122-4579144 GTTCTGCAGCAAAACAGGCTGGG + Intronic
1135300138 16:21319674-21319696 TTTCAGCAGCAGCACCAGGCTGG - Intergenic
1137582744 16:49643887-49643909 CGTCAGCAGCAGAAAGAGCCAGG + Intronic
1141895391 16:86955691-86955713 TTTCAGCAGCAGCCCAAACCGGG - Intergenic
1141948018 16:87323568-87323590 GTTCATCAGCAGAGCCAGGCAGG + Intronic
1142387583 16:89775754-89775776 CTTCAGCAGCAGAGCAGGCCTGG + Exonic
1144195698 17:12892759-12892781 GTTCAACAGCAGAACAGAGCGGG - Intronic
1144852060 17:18248865-18248887 GTCCAGCAGGAAAACAAACCTGG + Exonic
1147861180 17:43524505-43524527 TTTCAGCATCAGCACTAGCCGGG + Exonic
1149156439 17:53635687-53635709 CCTCAGCTGGAGAACAAGCCAGG + Intergenic
1149313754 17:55421066-55421088 GTTCAGCTGGAGAACCAGCAAGG + Intronic
1149544993 17:57496747-57496769 GTTCAGCACCTGAACAGGGCAGG + Intronic
1150612144 17:66742043-66742065 GTTCAGCAGAAGAAGAACACAGG + Intronic
1150796557 17:68242830-68242852 GTTCAAAACCAAAACAAGCCTGG + Intergenic
1151319919 17:73346866-73346888 GATCAGCAGCTGCACAGGCCAGG - Intronic
1152947935 17:83208072-83208094 GTTCAGCAGCAGGACTGGCTAGG + Intergenic
1153553102 18:6282969-6282991 GCCCATCAGCAGCACAAGCCAGG - Intronic
1153649264 18:7225128-7225150 CTTCACCAGCAGGGCAAGCCTGG - Intergenic
1157604761 18:48919126-48919148 GTTCAGCAGCGAACCAAGGCAGG + Intergenic
1161210552 19:3063080-3063102 GTTCTGCAGAAAAACCAGCCGGG + Exonic
1164415560 19:28044144-28044166 GTGCAGCAGAATAAAAAGCCAGG - Intergenic
1164520093 19:28972437-28972459 GTGCAGCAGAATAAAAAGCCAGG - Intergenic
1165433051 19:35783223-35783245 GGCCAGCAGCAGAATAAGCCTGG + Intronic
1166410590 19:42553642-42553664 GTTCAGCATCAGAGCAGCCCTGG - Intronic
925616374 2:5747949-5747971 GGTCATCAGGAGAACAAGCCAGG - Intergenic
927899340 2:26808042-26808064 GGGCAGCAGCAGAAGATGCCAGG + Intergenic
928425096 2:31171231-31171253 GTTCACCAGCAGAGCCAGCCAGG + Intergenic
928593218 2:32838110-32838132 GGGCAGCAGCAGAACCAGCCTGG + Intergenic
929539728 2:42810382-42810404 GTTCCGCAGCCGATCGAGCCGGG - Intergenic
930075260 2:47401160-47401182 ATTCAGCAGCAGAATCACCCTGG - Intergenic
931436916 2:62255649-62255671 GTTAAGAAACAAAACAAGCCGGG + Intergenic
935708470 2:105876961-105876983 TTTCTGCTGCAGAACAAGCAGGG - Intronic
938650753 2:133381059-133381081 TTTCAGCTCCAGAACAAGTCTGG + Intronic
940855862 2:158728378-158728400 GCTCTGAAGCAGAATAAGCCAGG + Intergenic
941040809 2:160621003-160621025 GATCAGCAGCAGCTCAATCCAGG + Intergenic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
943919375 2:193683230-193683252 GTTGAGAACCAGAACAAGCAAGG - Intergenic
947738926 2:232476093-232476115 ATTCAGCAGCAGGACAGGGCAGG - Intergenic
948839664 2:240642713-240642735 GTGCAGCAGCAGGACTCGCCTGG - Intergenic
1170122631 20:12927079-12927101 GTACAGCATCAGAACCAGCCTGG + Intergenic
1170216643 20:13898633-13898655 GGACAGGAGGAGAACAAGCCTGG - Intronic
1170382619 20:15777852-15777874 GTTCAAAACCAGAACCAGCCTGG - Intronic
1171179347 20:23081199-23081221 GTTCAGCAGCAGAACAAGCCAGG - Exonic
1173667430 20:44772838-44772860 GTACAGGAGCAGGGCAAGCCAGG + Intronic
1175983669 20:62753789-62753811 TGGCAGCAGCAGAACCAGCCAGG - Intronic
1176210431 20:63918219-63918241 TTTCAGAAGCAGATCAAGCCAGG + Intronic
1181935750 22:26437173-26437195 GGTCAGAAGCAGGATAAGCCTGG + Intronic
1183744809 22:39686189-39686211 GTTCAGCAGCACCAGCAGCCTGG + Exonic
1183992256 22:41605403-41605425 GATCAGCAGGAGAACAAATCTGG + Intronic
1184199009 22:42952257-42952279 TTTCAGCAGCACAGCAAACCAGG + Intronic
1184556027 22:45233564-45233586 CTTCAGCTGCAGAACAGCCCGGG + Intronic
1184588037 22:45460881-45460903 GCTCAGCGGCAGAGCAAGCATGG - Intergenic
1184662789 22:45973024-45973046 GCTCAGCACCAGCACAAGGCTGG - Intronic
1184908636 22:47510250-47510272 GTTCTTCAGCAGAAGAGGCCAGG + Intergenic
953257918 3:41307197-41307219 GTGCAGCAGCAGAAAAATACTGG + Intronic
953611226 3:44449189-44449211 GTTCAGCAGGAGTGCAGGCCAGG + Intronic
955154320 3:56401792-56401814 GTACAGCAGCAGCAGAAGCAGGG + Intronic
955778805 3:62462242-62462264 CTTCAGCAGCAGTAGCAGCCTGG - Intronic
955981547 3:64532434-64532456 GTTCAAAAGCAGAACACGCTCGG - Intronic
960632554 3:119747182-119747204 ATACTGCAGAAGAACAAGCCAGG + Exonic
963186295 3:142421043-142421065 GTGTCGCAGCAGAAGAAGCCAGG - Exonic
970289941 4:14561178-14561200 TTTTAGCAGCAGAAAAAGGCAGG + Intergenic
973856248 4:55013099-55013121 TTTCAGAAGGAAAACAAGCCTGG - Intergenic
982448545 4:155524113-155524135 GTACAGATGCAGAACAAGCAGGG - Intergenic
984856593 4:184200836-184200858 TGTCTGCAGCAGAACAACCCAGG - Intronic
987090478 5:14504895-14504917 GTTCAGCACCAGAGACAGCCTGG - Intronic
987379522 5:17272013-17272035 GTGCAGCAGCAGCACAATCTCGG - Intronic
1001942337 5:175749720-175749742 GTTCAGTGGCAGAGCCAGCCTGG + Intergenic
1002314371 5:178333711-178333733 GTCCATCTGCAGAACAAGCCTGG + Intronic
1002742100 5:181441226-181441248 GTTCAGCAGCAGGACTGGCTAGG + Intergenic
1004082481 6:12408235-12408257 CTTCAGCATCAGAACAAACGGGG + Intergenic
1004564054 6:16779264-16779286 GCTCTGCAACAGAACAGGCCAGG + Intergenic
1005334781 6:24784208-24784230 GCTAAGCAGCAAAACAATCCTGG - Intronic
1005821985 6:29606132-29606154 GTTCAGCAGAGGAACAAGTGGGG - Intronic
1007966290 6:46006533-46006555 GCTCAGAAGCAAGACAAGCCCGG - Intronic
1013941547 6:115669060-115669082 TTACAGAAGCAGAACAAGACTGG + Intergenic
1015851770 6:137581489-137581511 GTTCTGCAGCAGCACAAGTGTGG + Intergenic
1017234801 6:152108290-152108312 GGTCAGCAACAGAACAAGGCAGG - Intronic
1018180946 6:161223002-161223024 GTGAAGCAGCATCACAAGCCAGG - Intronic
1018868287 6:167761885-167761907 GTTTGGCAGCAGACCAAGCTGGG + Intergenic
1019247236 6:170716964-170716986 GTTCAGCAGCAGGACTGGCTAGG + Intergenic
1020026033 7:4900750-4900772 GATCAGCAGCAGAACAAGTGTGG + Intergenic
1021653212 7:22851410-22851432 TAACAGCAGCAAAACAAGCCAGG + Intergenic
1024761144 7:52597627-52597649 GAACAGCAGCACAAAAAGCCTGG + Intergenic
1025834847 7:65085045-65085067 GGCCAGCAGCACAACCAGCCAGG - Intergenic
1025904619 7:65774524-65774546 GGCCAGCAGCACAACCAGCCAGG - Intergenic
1028210850 7:88072737-88072759 GTTTATCAGCAGAGCCAGCCAGG - Intronic
1028365866 7:90031095-90031117 GTTCAGCAGTGGAATAAGTCAGG - Intergenic
1030396837 7:108996324-108996346 GTTCTGCTGCAAAACAAGACGGG + Intergenic
1032143330 7:129354523-129354545 TTTCAGCAGCAGAACAGTCCAGG + Intronic
1032764454 7:134977102-134977124 CTCCAGCAGCAGAACAAAGCTGG + Intergenic
1033713417 7:143974171-143974193 TGTCAGCTTCAGAACAAGCCAGG + Intergenic
1034594605 7:152177789-152177811 GTTCAGCAGCACAACATACTGGG - Exonic
1035388268 7:158488943-158488965 GTTCACCAGCATGACAGGCCCGG + Intronic
1035500899 8:90970-90992 GTTCAGCAGCAGGACTGGCTAGG - Intergenic
1036425695 8:8643463-8643485 GTTCAGCAGTGCACCAAGCCAGG - Intergenic
1037789539 8:21924991-21925013 ATTGAGCATCACAACAAGCCTGG + Intronic
1040484945 8:47861441-47861463 GTTCAGAAGAAGTACAAGGCAGG + Intronic
1042262127 8:66870679-66870701 GGTCAGCAGGGGAACTAGCCGGG - Intergenic
1044730572 8:95225725-95225747 TTTCAGCTGAAGGACAAGCCTGG + Intergenic
1045900118 8:107267930-107267952 GTTCAGCAGCTGTTCAAACCTGG - Intronic
1049222220 8:141433365-141433387 GGCTAGCAGCAGAACCAGCCAGG - Intergenic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1050952413 9:11614664-11614686 GTCCAGCAGCATAACAAACTTGG - Intergenic
1051067448 9:13121772-13121794 ATTGAGCTGCAGAAGAAGCCGGG - Exonic
1053653695 9:40194649-40194671 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1053904079 9:42823808-42823830 GTTGAACAGCAGAAGAAGCCAGG + Intergenic
1054530906 9:66181705-66181727 GTTGAACAGCAGAAGAAGCCAGG - Intergenic
1055829387 9:80360464-80360486 CTGCAGCAGCAGGACAACCCCGG - Intergenic
1057279293 9:93698577-93698599 GTTCAGCTTCAGCCCAAGCCCGG + Intergenic
1057430269 9:94987631-94987653 ATTCAGGAGCAGAACAACCTTGG - Intronic
1058793783 9:108477128-108477150 GTTCAGCAGGAGAAAGACCCTGG - Intergenic
1060277355 9:122192155-122192177 GTTCTGGAGCCGAACAAGCCTGG - Intronic
1060781762 9:126418227-126418249 GTTGAGTTGCAGAGCAAGCCAGG + Intronic
1061615145 9:131774445-131774467 GTTCAGCAAAAGAAGAAGCCAGG + Intergenic
1062085827 9:134647679-134647701 GTTCTGCCGCAGGGCAAGCCGGG + Intronic
1203608011 Un_KI270748v1:72442-72464 GTTCAGCAGCAGGACTGGCTAGG + Intergenic
1185452225 X:288793-288815 GTTCAGCAGCTGCAGCAGCCGGG - Exonic
1190561774 X:51693584-51693606 ATTAAGCAGCAAAACAAGCCAGG - Intergenic
1190891748 X:54574726-54574748 ATTCAGCAGCAAAGCAAGCTGGG + Intergenic
1200177250 X:154125787-154125809 GTCCAGCAGCAGGACTTGCCCGG - Intergenic