ID: 1171181667

View in Genome Browser
Species Human (GRCh38)
Location 20:23095328-23095350
Sequence CTGCCATATTGTCCCGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171181667_1171181670 -1 Left 1171181667 20:23095328-23095350 CCCAGTGCGGGACAATATGGCAG No data
Right 1171181670 20:23095350-23095372 GTGCTCTTCAAGGCCTCCGCTGG No data
1171181667_1171181673 23 Left 1171181667 20:23095328-23095350 CCCAGTGCGGGACAATATGGCAG No data
Right 1171181673 20:23095374-23095396 ACATCTTGTGTCTCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171181667 Original CRISPR CTGCCATATTGTCCCGCACT GGG (reversed) Intergenic