ID: 1171181670

View in Genome Browser
Species Human (GRCh38)
Location 20:23095350-23095372
Sequence GTGCTCTTCAAGGCCTCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171181668_1171181670 -2 Left 1171181668 20:23095329-23095351 CCAGTGCGGGACAATATGGCAGT No data
Right 1171181670 20:23095350-23095372 GTGCTCTTCAAGGCCTCCGCTGG No data
1171181665_1171181670 5 Left 1171181665 20:23095322-23095344 CCTGAGCCCAGTGCGGGACAATA No data
Right 1171181670 20:23095350-23095372 GTGCTCTTCAAGGCCTCCGCTGG No data
1171181667_1171181670 -1 Left 1171181667 20:23095328-23095350 CCCAGTGCGGGACAATATGGCAG No data
Right 1171181670 20:23095350-23095372 GTGCTCTTCAAGGCCTCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171181670 Original CRISPR GTGCTCTTCAAGGCCTCCGC TGG Intergenic