ID: 1171184684

View in Genome Browser
Species Human (GRCh38)
Location 20:23116897-23116919
Sequence AGAGCAGCAGCCTGATTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171184684_1171184686 0 Left 1171184684 20:23116897-23116919 CCTCCAAATCAGGCTGCTGCTCT No data
Right 1171184686 20:23116920-23116942 CTGTGTATCATCTCCCTCACTGG No data
1171184684_1171184693 26 Left 1171184684 20:23116897-23116919 CCTCCAAATCAGGCTGCTGCTCT No data
Right 1171184693 20:23116946-23116968 ACGACTCACCATCTGGCCTTGGG No data
1171184684_1171184689 19 Left 1171184684 20:23116897-23116919 CCTCCAAATCAGGCTGCTGCTCT No data
Right 1171184689 20:23116939-23116961 CTGGCCCACGACTCACCATCTGG No data
1171184684_1171184692 25 Left 1171184684 20:23116897-23116919 CCTCCAAATCAGGCTGCTGCTCT No data
Right 1171184692 20:23116945-23116967 CACGACTCACCATCTGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171184684 Original CRISPR AGAGCAGCAGCCTGATTTGG AGG (reversed) Intergenic
No off target data available for this crispr