ID: 1171187892

View in Genome Browser
Species Human (GRCh38)
Location 20:23136614-23136636
Sequence CAGCAAGCCGCAGAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171187887_1171187892 -7 Left 1171187887 20:23136598-23136620 CCAGAGGCCGCACAACCAGCAAG No data
Right 1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG No data
1171187886_1171187892 -3 Left 1171187886 20:23136594-23136616 CCAGCCAGAGGCCGCACAACCAG No data
Right 1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171187892 Original CRISPR CAGCAAGCCGCAGAGGTGGA CGG Intergenic
No off target data available for this crispr