ID: 1171188263

View in Genome Browser
Species Human (GRCh38)
Location 20:23138906-23138928
Sequence CCCTGGGTAAGGAGGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171188255_1171188263 5 Left 1171188255 20:23138878-23138900 CCAGCTGAAACAGAAGCACTGTG No data
Right 1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG No data
1171188254_1171188263 6 Left 1171188254 20:23138877-23138899 CCCAGCTGAAACAGAAGCACTGT No data
Right 1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG No data
1171188253_1171188263 9 Left 1171188253 20:23138874-23138896 CCACCCAGCTGAAACAGAAGCAC No data
Right 1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171188263 Original CRISPR CCCTGGGTAAGGAGGGAAGC CGG Intergenic
No off target data available for this crispr