ID: 1171191520

View in Genome Browser
Species Human (GRCh38)
Location 20:23162727-23162749
Sequence CAAGCAGGACCCTCTGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171191520_1171191528 -1 Left 1171191520 20:23162727-23162749 CCCAGTTCAGAGGGTCCTGCTTG No data
Right 1171191528 20:23162749-23162771 GGGGGCACGCCCTCTCCTGGAGG No data
1171191520_1171191527 -4 Left 1171191520 20:23162727-23162749 CCCAGTTCAGAGGGTCCTGCTTG No data
Right 1171191527 20:23162746-23162768 CTTGGGGGCACGCCCTCTCCTGG No data
1171191520_1171191534 27 Left 1171191520 20:23162727-23162749 CCCAGTTCAGAGGGTCCTGCTTG No data
Right 1171191534 20:23162777-23162799 AATGCTATAAAATTCCGTTAGGG No data
1171191520_1171191533 26 Left 1171191520 20:23162727-23162749 CCCAGTTCAGAGGGTCCTGCTTG No data
Right 1171191533 20:23162776-23162798 CAATGCTATAAAATTCCGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171191520 Original CRISPR CAAGCAGGACCCTCTGAACT GGG (reversed) Intergenic
No off target data available for this crispr