ID: 1171194337

View in Genome Browser
Species Human (GRCh38)
Location 20:23185866-23185888
Sequence AGGCCGGGTGTTGCCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171194337_1171194342 -1 Left 1171194337 20:23185866-23185888 CCAGGTGAGGCAACACCCGGCCT No data
Right 1171194342 20:23185888-23185910 TGCTTCAGCTTGCCCCCCGTGGG No data
1171194337_1171194341 -2 Left 1171194337 20:23185866-23185888 CCAGGTGAGGCAACACCCGGCCT No data
Right 1171194341 20:23185887-23185909 CTGCTTCAGCTTGCCCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171194337 Original CRISPR AGGCCGGGTGTTGCCTCACC TGG (reversed) Intergenic
No off target data available for this crispr