ID: 1171195026

View in Genome Browser
Species Human (GRCh38)
Location 20:23190091-23190113
Sequence TGCCATGTGGCCTCACATCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171195026 Original CRISPR TGCCATGTGGCCTCACATCG AGG (reversed) Intergenic
900877576 1:5355648-5355670 CACCATGTGTCCTCACATAGTGG - Intergenic
901184536 1:7364394-7364416 TTCTATGTGTCCTCACATGGTGG + Intronic
901376275 1:8841844-8841866 TTCTATGTGTCCTCACATGGTGG - Intergenic
902237166 1:15064826-15064848 CTCCCTGTGGCCTCGCATCGTGG + Intronic
914017607 1:143834703-143834725 CTCCATGTGTCCTCACATGGTGG + Intergenic
914656217 1:149743235-149743257 CTCCATGTGTCCTCACATGGTGG + Intergenic
917212756 1:172646825-172646847 TGCCATGTGAACTCACAGGGAGG + Intergenic
917837972 1:178955946-178955968 TGGCATGTGCCCTCACAGGGCGG + Intergenic
918746006 1:188200671-188200693 TTCTATGTGTCCTCACATGGTGG - Intergenic
919461851 1:197885987-197886009 TTCTATGTGTCCTCACATGGTGG + Intergenic
921290531 1:213652692-213652714 CTCCATGTGGCCTCACATGCAGG - Intergenic
1066539387 10:36428886-36428908 TTCCATGTGTCCTCACATGGTGG - Intergenic
1066645994 10:37609687-37609709 TTCCATGTGTCCTCACATGGTGG - Intergenic
1066662367 10:37749004-37749026 TGCCATGTGAGCACACATTGAGG + Intergenic
1067534733 10:47100669-47100691 TTCTATGTGTCCTCACATGGTGG - Intergenic
1067662921 10:48250014-48250036 GGCCAAGTGACCTCACATCCTGG - Intronic
1070652684 10:78249413-78249435 TGCAATGTGGCCTCACACCCAGG - Intergenic
1073646715 10:105312269-105312291 TTCCATGTGCCCTCACATGGTGG - Intergenic
1073708690 10:106015434-106015456 TTCCATATGGCCTCAAATCTAGG + Intergenic
1075471852 10:122697036-122697058 TGCAGTGTGGCCTCTCATCAAGG + Intergenic
1076812104 10:132892216-132892238 TGCCAAGTGGCTTCACGTCAGGG + Intronic
1077316859 11:1923242-1923264 GACCATGTGGCCACACTTCGGGG - Intronic
1080531527 11:33181115-33181137 ACCCATGTGGACTCACATGGAGG + Intergenic
1084747633 11:71183394-71183416 AGCCCTGTGGCCTCACAGCTGGG - Intronic
1090520157 11:127470563-127470585 GGCCATTTGGACTCACATAGAGG + Intergenic
1097647505 12:62253860-62253882 TGCCATGTGGACTTAAATCATGG - Intronic
1100581432 12:95943382-95943404 TGCCATGTCGCCTCGCGCCGAGG - Exonic
1101864667 12:108511721-108511743 TGCCATGTAGCCTCAAGCCGGGG + Intergenic
1103370082 12:120412687-120412709 TGGCATCTGGCCTCACACTGAGG - Intergenic
1106457220 13:29937944-29937966 TGGGATGTGGCATTACATCGGGG + Intergenic
1106484225 13:30158446-30158468 TTCCATGTGTCCTCACATGGTGG + Intergenic
1107610312 13:42106470-42106492 TGTGATATGGCCTCACATCCAGG + Intronic
1107999504 13:45893465-45893487 TTCGATGTGTCCTCACATGGTGG + Intergenic
1109746884 13:66635466-66635488 TGCCATGTGTTCACACATGGGGG + Intronic
1112156511 13:96823124-96823146 TTCCATGAGGCCTGACATCATGG - Intronic
1113019700 13:105870972-105870994 TGCAATGTGGTCTCACACTGTGG - Intergenic
1114083419 14:19220191-19220213 TACCATGTGGCCTCAGCTCTAGG + Intergenic
1121236189 14:92392784-92392806 TCCCATGTGACCTCACACAGTGG - Intronic
1121236197 14:92392833-92392855 TCCCATGTGACCTCACACAGAGG - Intronic
1121236210 14:92392931-92392953 TCCCATGTGACCTCACACAGAGG - Intronic
1126653498 15:50951368-50951390 TGCCATGTGGCCTCCCAACAGGG + Intronic
1127188697 15:56506988-56507010 TGCCCTGGGGCCCCACATCATGG + Intergenic
1127295172 15:57602632-57602654 TGCCATGTGGGCTCAGTTCGCGG - Intronic
1127956360 15:63857235-63857257 TAGCATCTGGCCTCACATCCTGG - Intergenic
1132058147 15:98668118-98668140 TGTCATGTGTCCTCACAGGGTGG + Intronic
1132650191 16:1017750-1017772 TGTGAGGTGGCCTCTCATCGTGG + Intergenic
1135001508 16:18780641-18780663 TGCCACGTGTCCTCACTTAGAGG - Intergenic
1137390920 16:48080996-48081018 TTCTATGTGTCCTCACATGGAGG + Intergenic
1137443113 16:48512647-48512669 TGCCCTGTGACCTCACCTCGTGG - Intergenic
1138162956 16:54773401-54773423 TGCCAGGTGGCCCCACTTCCAGG + Intergenic
1139575786 16:67841424-67841446 TGCCATGTGGCCTTACAGACTGG + Intronic
1140441860 16:74993993-74994015 TGCCATGTTCTCTCACATCTGGG + Intronic
1143762965 17:9118016-9118038 TGCCACGTGGCCTCAAATCCAGG + Intronic
1149675053 17:58452520-58452542 TCCCAGGTGGCCTCGCATGGTGG + Intronic
1151229684 17:72675296-72675318 TGCTGTGTAGCCTCACATAGTGG - Intronic
1151913199 17:77098069-77098091 TCTCATGGGGCCTCACATGGAGG + Intronic
1151919833 17:77145903-77145925 TTCCATGTGGCTTCAGCTCGAGG + Intronic
1152589522 17:81204505-81204527 TGCCTGGTGGCTTCACTTCGGGG - Intronic
1154235311 18:12600021-12600043 TGCCATGTGGGTTCCCAACGTGG - Intronic
1154500102 18:14991854-14991876 TACCATGTGGCCTCAGCTCTAGG + Intergenic
1156337026 18:36181410-36181432 TGCCATGTGGCCAGGCATGGTGG - Intergenic
1158883619 18:61804957-61804979 TGCCAAGTTGCCACACATTGCGG - Intergenic
1159738192 18:72130560-72130582 TGCCATGAGCCCTAACATCATGG - Intergenic
1161067824 19:2247274-2247296 TGCCAAGTGACCTCACTTCCTGG + Intronic
1162728872 19:12705891-12705913 TGCCATCTGGCCAGACCTCGAGG + Intronic
1165356745 19:35309224-35309246 TCCCAAGTGGCCTCATTTCGGGG - Intronic
1167806667 19:51791457-51791479 TTCCATATGTCCTCACATGGTGG + Intronic
925024848 2:599642-599664 TGCCCTGTGGCATCAGATAGTGG + Intergenic
925715310 2:6779590-6779612 TCCTATGTGACCTCACATAGGGG + Intergenic
930107177 2:47649478-47649500 TGCACTGTGTCCTCACATGGTGG - Intergenic
935130117 2:100255326-100255348 TCTCATGTGTCCTCACATGGTGG + Intergenic
939413782 2:141865846-141865868 TGGCATGTGAGCTCACATCTTGG + Intronic
940176255 2:150880776-150880798 TGCAATGGGGTCTCACATTGTGG - Intergenic
942246732 2:174014829-174014851 TGGCAGTTGGCCTCACATAGGGG + Intergenic
942663721 2:178293571-178293593 TGCAATGTGTAATCACATCGTGG + Intronic
942674186 2:178410396-178410418 TGTGATGTGGCATCTCATCGTGG - Intergenic
947324813 2:228962632-228962654 TGCCATGTGGCTTCACAGATTGG + Intronic
947337954 2:229106603-229106625 TTCTATGTGTCCTCACATGGTGG - Intronic
1169546790 20:6658678-6658700 TCCCATGTGGCTTGACATCATGG + Intergenic
1171195026 20:23190091-23190113 TGCCATGTGGCCTCACATCGAGG - Intergenic
1171381762 20:24738769-24738791 TTCCATGTGTCCTCACATGGTGG - Intergenic
1171493678 20:25539357-25539379 GGCCCTGCGGCCTCACAGCGAGG - Intronic
1172779551 20:37427801-37427823 TGCCATGTGCCCTACCATGGAGG + Intergenic
1174160619 20:48547779-48547801 TGCCATGTGGCCTCACACGCTGG + Intergenic
1174881000 20:54279643-54279665 TTCCATGTGTCCTCTCATGGTGG + Intergenic
1175078520 20:56397004-56397026 ACCCATGTGGCCTCACAGCGTGG + Intronic
1177165860 21:17603000-17603022 TGTCATGTGGTCTGACATAGAGG - Intronic
1179158569 21:38873463-38873485 TGCCTTGTGGACTCACACAGAGG - Intergenic
1180083399 21:45496936-45496958 TGCTATGTGGCCTCATACAGGGG + Intronic
1180294556 22:10873076-10873098 TACCATGTGGCCTCAGCTCTAGG - Intergenic
1180497362 22:15902490-15902512 TACCATGTGGCCTCAGCTCTAGG - Intergenic
1181171957 22:21014927-21014949 TGCCCTCTGGCCTCACTTCCTGG - Intronic
1181685533 22:24525282-24525304 CTCCATGTGGCATCTCATCGTGG - Intronic
1181860436 22:25813767-25813789 TGCCATGTGGCCTAGCATCCTGG + Intronic
1182063921 22:27417084-27417106 TGCCTTGTGGCCTCACTTCCTGG + Intergenic
1184141488 22:42580294-42580316 TGCCGTGTGCTCTCACATAGAGG + Intergenic
1184596339 22:45516343-45516365 AGCCATGTGGCCTGACAGCGAGG - Intronic
1185156438 22:49196010-49196032 TCCTGTGTGACCTCACATCGGGG - Intergenic
949714722 3:6916592-6916614 TTCTATGTGTCCTCACATGGTGG + Intronic
957005763 3:74944849-74944871 TGCCCTGTGTCCTCACATGGCGG - Intergenic
960598840 3:119434797-119434819 AGCCATGGGGCCTTACAACGTGG - Exonic
961098034 3:124174580-124174602 TGCCAAATGGCCTAACATCCTGG - Intronic
961871594 3:129992609-129992631 TGCCATGAGTGCTCACATAGCGG + Intergenic
963931719 3:151010315-151010337 TGCCATGTGTCATCACATCATGG + Intergenic
963958890 3:151285835-151285857 TGCCCTGTGTCCTTACATGGCGG - Intronic
968798012 4:2721989-2722011 TGCTGTGTGGCCTCATATCGAGG - Intronic
969967149 4:11008762-11008784 TTCCATGTGGCCTCTCCACGTGG + Intergenic
973784791 4:54324599-54324621 TGCCATGTGGCCTCTCCTTCTGG - Intergenic
973903058 4:55497400-55497422 TGCCATGTACCCTAACATAGTGG + Intronic
980281736 4:130731962-130731984 TGCCCTCTGGCCTCACATCTGGG - Intergenic
984644379 4:182203747-182203769 TGGCAGGTGGCCCCTCATCGTGG + Intronic
987070222 5:14329438-14329460 TTCTATGTGTCCTCACATGGAGG - Intronic
988827258 5:34950743-34950765 TGCCATGTGTCCTCACAACATGG - Intronic
991504165 5:67306731-67306753 TTTCATGGGGCCTCACATAGAGG - Intergenic
995677624 5:114681051-114681073 TTCCATGTGGCCTGGCATGGAGG + Intergenic
996692802 5:126358687-126358709 TGCCATGTGGTCTCATGTGGAGG + Intergenic
999424581 5:151476258-151476280 TGCCATGTGGCCTCACTCACAGG + Intronic
999860833 5:155643836-155643858 TTCCATGTGGCCTCTCAGCATGG - Intergenic
1003045598 6:2730226-2730248 TGCCCTGTTGGCTCACATCTTGG - Intronic
1005599378 6:27411179-27411201 TGCTATATGGCCTCACATAGGGG + Intergenic
1006424721 6:33956779-33956801 TGCCATGTCACCTCACCTCTCGG - Intergenic
1006595971 6:35192681-35192703 TGCCAAGAGGCCTCCCATCCAGG - Intergenic
1010974448 6:82296744-82296766 CTCCATGTGTCCTCACATGGTGG + Intergenic
1014766039 6:125407821-125407843 TGCCATGTGGGGCCACATAGGGG - Intergenic
1015175720 6:130305993-130306015 TACAATGTGTCCTCACATGGTGG + Intronic
1017371467 6:153714221-153714243 TGCACTGTGCCCTCACATGGGGG + Intergenic
1021392941 7:20116736-20116758 TGTCATATGCCCTAACATCGAGG - Intergenic
1022059862 7:26782803-26782825 TTCTATGTGCCCTCACATGGTGG - Intronic
1022172304 7:27841958-27841980 TGCAATGTAGCCTCACACCTGGG - Intronic
1026883137 7:73920012-73920034 TCCCATGTGCCCTCTCATCTGGG - Intergenic
1030274966 7:107710694-107710716 TGCCATGAGGCCTCCCATCAGGG - Intronic
1034546770 7:151794484-151794506 TGCCACGGGGGCTCACACCGCGG - Intronic
1035269111 7:157709606-157709628 GGCCATGTGGCTGCACAACGTGG - Intronic
1037185000 8:16052467-16052489 GGCCATGTGGCCACACATCGTGG - Intergenic
1038231601 8:25705814-25705836 AGCCATGTGGGCTGACATCATGG - Intergenic
1053291301 9:36881415-36881437 TGCCATGTCTCCTTACATTGTGG - Intronic
1055325515 9:75124207-75124229 TGCAATGTGGAATCACATCATGG + Intronic
1056588603 9:87945645-87945667 TGCTATGTGTCCTCACAAGGTGG - Intergenic
1057291149 9:93808290-93808312 TGCCCTGTGTCCTCACAGTGAGG - Intergenic
1059327738 9:113514564-113514586 TGGCATGCGGCCTCACAACCGGG - Exonic
1061359327 9:130131278-130131300 AGCCAGGTTTCCTCACATCGTGG + Intronic
1197034410 X:121856280-121856302 TGCCTTGTGACCTCACTTCTAGG + Intergenic