ID: 1171196096

View in Genome Browser
Species Human (GRCh38)
Location 20:23200808-23200830
Sequence ACAATGGGGGCCGTTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171196084_1171196096 30 Left 1171196084 20:23200755-23200777 CCCTTCTGCCGTGCACTGAAGCC No data
Right 1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG No data
1171196087_1171196096 9 Left 1171196087 20:23200776-23200798 CCACGATGATGTAAGTCCGAGCA No data
Right 1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG No data
1171196086_1171196096 22 Left 1171196086 20:23200763-23200785 CCGTGCACTGAAGCCACGATGAT No data
Right 1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG No data
1171196085_1171196096 29 Left 1171196085 20:23200756-23200778 CCTTCTGCCGTGCACTGAAGCCA No data
Right 1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG No data
1171196089_1171196096 -7 Left 1171196089 20:23200792-23200814 CCGAGCAGCCAGGTGCACAATGG No data
Right 1171196096 20:23200808-23200830 ACAATGGGGGCCGTTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171196096 Original CRISPR ACAATGGGGGCCGTTCTCAA GGG Intergenic
No off target data available for this crispr