ID: 1171196775

View in Genome Browser
Species Human (GRCh38)
Location 20:23206053-23206075
Sequence CAGGCTCCTGCACCTGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171196775_1171196780 2 Left 1171196775 20:23206053-23206075 CCCTGACCAGGTGCAGGAGCCTG No data
Right 1171196780 20:23206078-23206100 TCCGAATCCACCTCTGCCATGGG No data
1171196775_1171196779 1 Left 1171196775 20:23206053-23206075 CCCTGACCAGGTGCAGGAGCCTG No data
Right 1171196779 20:23206077-23206099 TTCCGAATCCACCTCTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171196775 Original CRISPR CAGGCTCCTGCACCTGGTCA GGG (reversed) Intergenic
No off target data available for this crispr