ID: 1171201838

View in Genome Browser
Species Human (GRCh38)
Location 20:23247945-23247967
Sequence CTGTGAAAGGAGGAGGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171201824_1171201838 -8 Left 1171201824 20:23247930-23247952 CCCCACCCAGAGCCCCTGTGAAA No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201822_1171201838 0 Left 1171201822 20:23247922-23247944 CCCTTGTTCCCCACCCAGAGCCC No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201823_1171201838 -1 Left 1171201823 20:23247923-23247945 CCTTGTTCCCCACCCAGAGCCCC No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201825_1171201838 -9 Left 1171201825 20:23247931-23247953 CCCACCCAGAGCCCCTGTGAAAG No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201818_1171201838 29 Left 1171201818 20:23247893-23247915 CCTGAAGGGGAGTCCCCATCACA No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201819_1171201838 16 Left 1171201819 20:23247906-23247928 CCCCATCACACACAAGCCCTTGT No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201820_1171201838 15 Left 1171201820 20:23247907-23247929 CCCATCACACACAAGCCCTTGTT No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201821_1171201838 14 Left 1171201821 20:23247908-23247930 CCATCACACACAAGCCCTTGTTC No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data
1171201826_1171201838 -10 Left 1171201826 20:23247932-23247954 CCACCCAGAGCCCCTGTGAAAGG No data
Right 1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171201838 Original CRISPR CTGTGAAAGGAGGAGGGGGA CGG Intergenic
No off target data available for this crispr