ID: 1171201982

View in Genome Browser
Species Human (GRCh38)
Location 20:23249516-23249538
Sequence ACAAATGGAAATGACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171201982_1171201984 1 Left 1171201982 20:23249516-23249538 CCTTGAAAGTCATTTCCATTTGT No data
Right 1171201984 20:23249540-23249562 GAGTCAGTGCCTGCCTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171201982 Original CRISPR ACAAATGGAAATGACTTTCA AGG (reversed) Intergenic