ID: 1171204762

View in Genome Browser
Species Human (GRCh38)
Location 20:23270211-23270233
Sequence CGGGGGATGGTGCCCCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171204754_1171204762 4 Left 1171204754 20:23270184-23270206 CCAGGACAGACAGAAGTGTCTGG No data
Right 1171204762 20:23270211-23270233 CGGGGGATGGTGCCCCACAAAGG No data
1171204753_1171204762 5 Left 1171204753 20:23270183-23270205 CCCAGGACAGACAGAAGTGTCTG No data
Right 1171204762 20:23270211-23270233 CGGGGGATGGTGCCCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171204762 Original CRISPR CGGGGGATGGTGCCCCACAA AGG Intergenic
No off target data available for this crispr