ID: 1171205098

View in Genome Browser
Species Human (GRCh38)
Location 20:23272923-23272945
Sequence CTGTGAATCTAGAAGAGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171205098_1171205101 24 Left 1171205098 20:23272923-23272945 CCATAACTCTTCTAGATTCACAG No data
Right 1171205101 20:23272970-23272992 AAGTAGGAGCTGTCACTCAGAGG No data
1171205098_1171205100 8 Left 1171205098 20:23272923-23272945 CCATAACTCTTCTAGATTCACAG No data
Right 1171205100 20:23272954-23272976 GTTGAAAGACTATGATAAGTAGG No data
1171205098_1171205102 29 Left 1171205098 20:23272923-23272945 CCATAACTCTTCTAGATTCACAG No data
Right 1171205102 20:23272975-23272997 GGAGCTGTCACTCAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171205098 Original CRISPR CTGTGAATCTAGAAGAGTTA TGG (reversed) Intergenic
No off target data available for this crispr