ID: 1171210898

View in Genome Browser
Species Human (GRCh38)
Location 20:23316178-23316200
Sequence CAGACTAGGACATCCCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171210898_1171210906 4 Left 1171210898 20:23316178-23316200 CCACCTAGGGATGTCCTAGTCTG No data
Right 1171210906 20:23316205-23316227 TGGGGAAGTAGTGCTCCTTTGGG No data
1171210898_1171210905 3 Left 1171210898 20:23316178-23316200 CCACCTAGGGATGTCCTAGTCTG No data
Right 1171210905 20:23316204-23316226 TTGGGGAAGTAGTGCTCCTTTGG No data
1171210898_1171210907 11 Left 1171210898 20:23316178-23316200 CCACCTAGGGATGTCCTAGTCTG No data
Right 1171210907 20:23316212-23316234 GTAGTGCTCCTTTGGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171210898 Original CRISPR CAGACTAGGACATCCCTAGG TGG (reversed) Intergenic
No off target data available for this crispr