ID: 1171211766

View in Genome Browser
Species Human (GRCh38)
Location 20:23322263-23322285
Sequence GTTCTGTTCCTAAGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171211758_1171211766 2 Left 1171211758 20:23322238-23322260 CCCTCCCACTTCAAAATAATCGG No data
Right 1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG No data
1171211760_1171211766 1 Left 1171211760 20:23322239-23322261 CCTCCCACTTCAAAATAATCGGG No data
Right 1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG No data
1171211762_1171211766 -2 Left 1171211762 20:23322242-23322264 CCCACTTCAAAATAATCGGGAGT No data
Right 1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG No data
1171211763_1171211766 -3 Left 1171211763 20:23322243-23322265 CCACTTCAAAATAATCGGGAGTT No data
Right 1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG No data
1171211757_1171211766 9 Left 1171211757 20:23322231-23322253 CCATGTGCCCTCCCACTTCAAAA No data
Right 1171211766 20:23322263-23322285 GTTCTGTTCCTAAGGAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171211766 Original CRISPR GTTCTGTTCCTAAGGAAAAA GGG Intergenic
No off target data available for this crispr