ID: 1171211939

View in Genome Browser
Species Human (GRCh38)
Location 20:23324018-23324040
Sequence ACCTGCACCCAGGTTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171211939_1171211946 13 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211946 20:23324054-23324076 ACTCAAAGTGTGCATGGGGCTGG No data
1171211939_1171211949 27 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211949 20:23324068-23324090 TGGGGCTGGGCTTCTTCTTTGGG No data
1171211939_1171211944 8 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211944 20:23324049-23324071 GCTGAACTCAAAGTGTGCATGGG No data
1171211939_1171211947 14 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211947 20:23324055-23324077 CTCAAAGTGTGCATGGGGCTGGG No data
1171211939_1171211948 26 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211948 20:23324067-23324089 ATGGGGCTGGGCTTCTTCTTTGG No data
1171211939_1171211945 9 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211945 20:23324050-23324072 CTGAACTCAAAGTGTGCATGGGG No data
1171211939_1171211943 7 Left 1171211939 20:23324018-23324040 CCTCTAGAAACCTGGGTGCAGGT No data
Right 1171211943 20:23324048-23324070 GGCTGAACTCAAAGTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171211939 Original CRISPR ACCTGCACCCAGGTTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr