ID: 1171212583

View in Genome Browser
Species Human (GRCh38)
Location 20:23328130-23328152
Sequence CTGGGGAGACCTTCGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171212583_1171212595 9 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212583_1171212590 -3 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212590 20:23328150-23328172 CAGCAGCCGGCACCCTGCACAGG No data
1171212583_1171212593 6 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212593 20:23328159-23328181 GCACCCTGCACAGGGTTCACAGG No data
1171212583_1171212591 -2 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171212583 Original CRISPR CTGGGGAGACCTTCGGATGG TGG (reversed) Intergenic
No off target data available for this crispr