ID: 1171212591

View in Genome Browser
Species Human (GRCh38)
Location 20:23328151-23328173
Sequence AGCAGCCGGCACCCTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171212584_1171212591 -5 Left 1171212584 20:23328133-23328155 CCATCCGAAGGTCTCCCCAGCAG No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data
1171212585_1171212591 -9 Left 1171212585 20:23328137-23328159 CCGAAGGTCTCCCCAGCAGCCGG No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data
1171212582_1171212591 5 Left 1171212582 20:23328123-23328145 CCGCTGGCCACCATCCGAAGGTC No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data
1171212583_1171212591 -2 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data
1171212577_1171212591 29 Left 1171212577 20:23328099-23328121 CCTGAAAGCTCTATACCGCTCTG No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data
1171212580_1171212591 14 Left 1171212580 20:23328114-23328136 CCGCTCTGGCCGCTGGCCACCAT No data
Right 1171212591 20:23328151-23328173 AGCAGCCGGCACCCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171212591 Original CRISPR AGCAGCCGGCACCCTGCACA GGG Intergenic
No off target data available for this crispr