ID: 1171212595

View in Genome Browser
Species Human (GRCh38)
Location 20:23328162-23328184
Sequence CCCTGCACAGGGTTCACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171212584_1171212595 6 Left 1171212584 20:23328133-23328155 CCATCCGAAGGTCTCCCCAGCAG No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212585_1171212595 2 Left 1171212585 20:23328137-23328159 CCGAAGGTCTCCCCAGCAGCCGG No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212583_1171212595 9 Left 1171212583 20:23328130-23328152 CCACCATCCGAAGGTCTCCCCAG No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212582_1171212595 16 Left 1171212582 20:23328123-23328145 CCGCTGGCCACCATCCGAAGGTC No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212587_1171212595 -8 Left 1171212587 20:23328147-23328169 CCCCAGCAGCCGGCACCCTGCAC No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212588_1171212595 -9 Left 1171212588 20:23328148-23328170 CCCAGCAGCCGGCACCCTGCACA No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212580_1171212595 25 Left 1171212580 20:23328114-23328136 CCGCTCTGGCCGCTGGCCACCAT No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data
1171212589_1171212595 -10 Left 1171212589 20:23328149-23328171 CCAGCAGCCGGCACCCTGCACAG No data
Right 1171212595 20:23328162-23328184 CCCTGCACAGGGTTCACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171212595 Original CRISPR CCCTGCACAGGGTTCACAGG AGG Intergenic
No off target data available for this crispr