ID: 1171215320

View in Genome Browser
Species Human (GRCh38)
Location 20:23348391-23348413
Sequence CAGGCTCAGTGGCCCTAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171215315_1171215320 -6 Left 1171215315 20:23348374-23348396 CCTTCAGCAAACACCTCCAGGCT No data
Right 1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG No data
1171215312_1171215320 2 Left 1171215312 20:23348366-23348388 CCCAGAATCCTTCAGCAAACACC No data
Right 1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG No data
1171215310_1171215320 7 Left 1171215310 20:23348361-23348383 CCTTCCCCAGAATCCTTCAGCAA No data
Right 1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG No data
1171215313_1171215320 1 Left 1171215313 20:23348367-23348389 CCAGAATCCTTCAGCAAACACCT No data
Right 1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG No data
1171215311_1171215320 3 Left 1171215311 20:23348365-23348387 CCCCAGAATCCTTCAGCAAACAC No data
Right 1171215320 20:23348391-23348413 CAGGCTCAGTGGCCCTAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171215320 Original CRISPR CAGGCTCAGTGGCCCTAATT GGG Intergenic
No off target data available for this crispr