ID: 1171216263

View in Genome Browser
Species Human (GRCh38)
Location 20:23354773-23354795
Sequence CTGGTCAAACACATCAGACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171216263_1171216269 -7 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216269 20:23354789-23354811 TGACCAGGTTGTGAGGGAGGAGG 0: 1
1: 0
2: 0
3: 28
4: 321
1171216263_1171216274 20 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216274 20:23354816-23354838 CTAAAGGCAGAAAGCATAATAGG 0: 1
1: 0
2: 0
3: 28
4: 314
1171216263_1171216271 -4 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216271 20:23354792-23354814 CCAGGTTGTGAGGGAGGAGGAGG 0: 1
1: 0
2: 10
3: 152
4: 923
1171216263_1171216273 4 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216273 20:23354800-23354822 TGAGGGAGGAGGAGGGCTAAAGG 0: 1
1: 0
2: 3
3: 109
4: 1246
1171216263_1171216268 -10 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216268 20:23354786-23354808 GTTTGACCAGGTTGTGAGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 240
1171216263_1171216272 -3 Left 1171216263 20:23354773-23354795 CCCTGTCTGATGTGTTTGACCAG 0: 1
1: 0
2: 2
3: 15
4: 201
Right 1171216272 20:23354793-23354815 CAGGTTGTGAGGGAGGAGGAGGG 0: 1
1: 2
2: 6
3: 124
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171216263 Original CRISPR CTGGTCAAACACATCAGACA GGG (reversed) Exonic
900963221 1:5939264-5939286 CTGGTGAAACTCTTCACACAGGG + Intronic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
906646828 1:47481178-47481200 CTGTTCAGACACATCTTACATGG + Intergenic
908676438 1:66609513-66609535 CTGGAGAAATACATCAGACCAGG + Intronic
909273906 1:73660119-73660141 CTGCTGAAACAAATCAGAGATGG + Intergenic
910554116 1:88511360-88511382 CTGGTCAAACACATCAATCAAGG - Intergenic
911121057 1:94297023-94297045 ATGGTCACACAAATCAGACCTGG - Intergenic
911424157 1:97685814-97685836 CTGCTCAAAGAAATCAGAGAGGG + Intronic
913957664 1:143319441-143319463 CTGGTCAAACACACAGGGCATGG - Intergenic
914051974 1:144144805-144144827 CTGGTCAAACACACAGGGCATGG - Intergenic
914127223 1:144821736-144821758 CTGGTCAAACACACAGGGCATGG + Intergenic
917195614 1:172462041-172462063 CTGGTCATTCACATCACAAAAGG + Intronic
917643751 1:177009071-177009093 CTGGTCAAAGAAACAAGACATGG + Intronic
918956363 1:191213675-191213697 CTGCTCAAAGAAATCAGAGAGGG - Intergenic
921971948 1:221159551-221159573 TGGGTTAAACAGATCAGACATGG + Intergenic
922917808 1:229272423-229272445 CTGCAGAAACACAGCAGACACGG + Intronic
1064797655 10:19031498-19031520 CTAGACAAACAAATCAGATATGG - Intergenic
1065499537 10:26365800-26365822 ATGTTCAAACACATCAGCAATGG + Intergenic
1066760008 10:38741142-38741164 CTGGTCAAACACATAGGGCATGG + Intergenic
1066961609 10:42231626-42231648 CTGGTCAAACACACAGGGCATGG - Intergenic
1067286201 10:44909163-44909185 CTGGTCAAATAGCCCAGACAGGG - Intergenic
1068055614 10:52009504-52009526 CTGCTCAAACAAATCAGAAATGG + Intronic
1069263114 10:66423902-66423924 CTGGCCAAAGACACCAGACATGG - Intronic
1075073034 10:119331400-119331422 CTGGGCAAACACCTCAGCGACGG - Intronic
1075988145 10:126806265-126806287 CTGGTCTAATACATCCTACAAGG + Intergenic
1077023352 11:429462-429484 CGGGACACACACCTCAGACACGG + Intronic
1079281315 11:19089637-19089659 CTGGGGAAACAGGTCAGACAAGG - Intergenic
1082829845 11:57608031-57608053 ATGGTCAAATACATTAGATAGGG - Intronic
1085199393 11:74692626-74692648 CTTGTTAACCATATCAGACAAGG - Intergenic
1085444885 11:76593943-76593965 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1086086821 11:82963958-82963980 CTGCTCAAAGAAATCAGAGATGG - Intronic
1086510419 11:87551644-87551666 CTGGTCAAAGAAATTAGAGATGG - Intergenic
1087731620 11:101784516-101784538 CTGCTCAAAGATATCAGAGATGG - Intronic
1088149903 11:106731879-106731901 CTGCTCAAAGAAATCAGAGATGG + Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1094157543 12:27352909-27352931 CTGCTCAAAGAAATCAGAGATGG + Intronic
1096034356 12:48451819-48451841 CTGCTCAAAGAAATCAGAAATGG + Intergenic
1096858556 12:54505241-54505263 CTTGCCTAACACACCAGACAGGG - Intronic
1098227140 12:68336157-68336179 ATGAGCAAACACATCAGACGAGG + Intergenic
1101173968 12:102129666-102129688 CTGCTCAAAGAAATCAGAGAAGG - Intronic
1102520423 12:113474698-113474720 CTGGAAACACACACCAGACAGGG - Intergenic
1104396823 12:128441226-128441248 ACGGTCAACCTCATCAGACAGGG + Intronic
1106372572 13:29150176-29150198 CTGCTCAAAGAAATCAGAGAGGG - Intronic
1107090461 13:36473802-36473824 CTCTTCAAACATGTCAGACAGGG + Intergenic
1107794058 13:44031728-44031750 CTGCTCACACACACCATACAGGG + Intergenic
1107806913 13:44161879-44161901 CAGGTCAAATACATCAGTAATGG + Intergenic
1110370284 13:74732476-74732498 CTGGTCTAACACTTATGACAGGG - Intergenic
1110488755 13:76077868-76077890 CTGCTCAAAGCAATCAGACAGGG - Intergenic
1111360863 13:87173773-87173795 GTGGCCAAACGCATGAGACAAGG - Intergenic
1112102607 13:96206293-96206315 CTGCTCAAAGAAATCAGAGAGGG + Intronic
1113036590 13:106056570-106056592 CTGTTCAAACACAGCAGAACAGG - Intergenic
1113227290 13:108173248-108173270 CTGCTCAAAGAAATCAGAGAAGG + Intergenic
1113645769 13:111994438-111994460 CTGCTCAGACACAACAGGCAGGG + Intergenic
1115278950 14:31639604-31639626 CTCTTCAAAGATATCAGACAGGG + Intronic
1115655236 14:35437691-35437713 AAGGTCAAACACATCAAGCAGGG - Intergenic
1119306195 14:73610030-73610052 CTGGATAAACACCTCAGGCATGG + Intergenic
1120588134 14:86341472-86341494 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1122915856 14:104858519-104858541 CTGGACACACACATCAGAGCAGG - Intergenic
1202930717 14_KI270725v1_random:30649-30671 CTGGTCAAACACACAGGGCATGG + Intergenic
1123421639 15:20140763-20140785 CTGGTCAAACACACAGGGCATGG - Intergenic
1123530865 15:21147303-21147325 CTGGTCAAACACACAGGGCATGG - Intergenic
1126054555 15:44717769-44717791 CTGCTCAGATACATCAAACATGG - Exonic
1126189574 15:45865684-45865706 CTAGTTAAAAACATAAGACATGG + Intergenic
1127093021 15:55485131-55485153 CTGGCCAAAGACATCAGAACAGG + Intronic
1128049314 15:64649578-64649600 CTGGTTTAACCCATCAGGCAGGG - Intronic
1131230058 15:90653191-90653213 CTGGCCAGACCCATCAGAGAGGG + Intergenic
1136722797 16:32338134-32338156 CTGGTCAAACACACAGGGCATGG - Intergenic
1136841120 16:33544133-33544155 CTGGTCAAACACACCGGGCGTGG - Intergenic
1139491604 16:67288941-67288963 ATGGCCACACACATCAGAAAGGG - Exonic
1140023512 16:71262098-71262120 CTTGTCATACAAGTCAGACATGG + Intergenic
1203003634 16_KI270728v1_random:179630-179652 CTGGTCAAACACACAGGGCATGG + Intergenic
1203135242 16_KI270728v1_random:1716037-1716059 CTGGTCAAACACACAGGGCATGG + Intergenic
1203151285 16_KI270728v1_random:1844430-1844452 CTGGTCAAACACACCGGGCGTGG - Intergenic
1144125567 17:12199480-12199502 TTGTTTAAACTCATCAGACAGGG - Intergenic
1144664580 17:17093287-17093309 TAGGTCAAACTCCTCAGACAGGG - Intronic
1145883621 17:28368588-28368610 GTGTTCAAACACAGCCGACAGGG + Exonic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1150853445 17:68727584-68727606 CTGCTCAAAAAAATCAGAGATGG + Intergenic
1153752973 18:8252629-8252651 GTGGACCAACACATCACACATGG - Intronic
1155737304 18:29239627-29239649 CTGGACAAAGACATGACACAGGG + Intergenic
1157637879 18:49179358-49179380 CTGTTCAAACAAATTAGAAATGG - Intronic
1159976819 18:74723651-74723673 CTGCTCCAACACAACAGACATGG - Intronic
1161222844 19:3125997-3126019 CTCCTCCAACACATCAGGCATGG - Intergenic
1162663143 19:12186442-12186464 ATGCTCAAACAAATCAGACTTGG + Intronic
1165526187 19:36356923-36356945 GTGGTAAAACATATCTGACAAGG - Intronic
1202691373 1_KI270712v1_random:97229-97251 CTGGTCAAACACACAGGGCATGG - Intergenic
926644269 2:15272126-15272148 CTGGTAAAACATACCAGAGAAGG - Intronic
927594273 2:24383124-24383146 ATAATCAAACCCATCAGACAGGG + Intergenic
930928901 2:56856733-56856755 CTGCTCAAAAAAATCAGAGATGG - Intergenic
931880433 2:66564153-66564175 GTGGTCAAACAGCTCAGAAAAGG + Intronic
933183391 2:79252043-79252065 CAGATCAAACACACCAGAAAGGG + Intronic
933955017 2:87356721-87356743 CTGGTCAAACACACAGGGCATGG + Intergenic
934239208 2:90252935-90252957 CTGGTCAAACACACAGGGCATGG + Intergenic
934273977 2:91563763-91563785 CTGGTCAAACACACAGGGCATGG - Intergenic
934323326 2:91985483-91985505 CTGGTCAAACACACAGGGCATGG + Intergenic
934461649 2:94216289-94216311 CTGGTCAAACACACAGGGCATGG + Intergenic
935720601 2:105975818-105975840 CAGGTCAAACCCTTCAGGCAAGG - Intergenic
938628798 2:133142209-133142231 TTGGTTAACCACATCAGTCAAGG + Intronic
940360850 2:152794059-152794081 GTAGTCAAACACTTCAGAAAGGG + Intergenic
943911124 2:193569295-193569317 CTGCTCAAATAAATCAGAGAGGG - Intergenic
949054479 2:241919542-241919564 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1170818040 20:19731531-19731553 CTGGCCACACATATCAGGCATGG + Intergenic
1170972578 20:21129927-21129949 CTTCTCAAACAGATCAGAAAAGG - Intronic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1172021024 20:31914037-31914059 CTGGTCTAACACTTCACACACGG + Intronic
1173431149 20:42988061-42988083 CTGATCACACACATCAGCCCTGG + Intronic
1174165989 20:48583946-48583968 CTCCTCAAACACAACAGGCATGG - Intergenic
1176592738 21:8659272-8659294 CTGGTCAAACACACAGGGCATGG + Intergenic
1177733795 21:25063087-25063109 CTGGTAAATCACTTCAAACATGG + Intergenic
1177762368 21:25416701-25416723 CTTGTCAAACACTTTAGAGAGGG + Intergenic
1180275591 22:10636414-10636436 CTGGTCAAACACACAGGGCATGG + Intergenic
1180550069 22:16531354-16531376 CTGGTCAAACACACAGGGCATGG + Intergenic
1180920991 22:19521603-19521625 CTGACCAAACACACCAGACCTGG + Intergenic
953282869 3:41575560-41575582 CTGATCAAAGACATGAGAGAAGG + Intronic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
955492261 3:59494885-59494907 CTGCTCAAAGAAATCAGAGATGG - Intergenic
959779101 3:110206535-110206557 CTGCTCAAAGAAATCAGACATGG + Intergenic
960799015 3:121519147-121519169 CTGGTCTCAGAAATCAGACAAGG - Intronic
961115551 3:124326137-124326159 CTGGTGGAACACAGCAGACATGG - Exonic
961352369 3:126312010-126312032 CTGGTCAGCCAAATCAGCCAGGG - Intergenic
961688571 3:128652297-128652319 CTAGTCATAAATATCAGACAAGG + Intronic
964296151 3:155235708-155235730 CAGGTCAAAGAAATCAGAGATGG - Intergenic
966341658 3:178931643-178931665 CTGCTCAAAGAAATCAGAGAAGG + Intergenic
969400455 4:6952057-6952079 CTGGTCTAGCACATCAGCTATGG - Intronic
970509793 4:16770211-16770233 CATGTAAAACACACCAGACATGG - Intronic
973674042 4:53246176-53246198 CTGCTCAAAAAAATCAGAGATGG + Intronic
975404427 4:73973361-73973383 CTGCTCAAAGAAATCAGAGATGG + Intergenic
977273554 4:94948066-94948088 CCAGTGACACACATCAGACAGGG + Intronic
979116761 4:116834174-116834196 CTGCTCAAAGAAATCAGAGATGG + Intergenic
979158180 4:117424786-117424808 CTGCTCAAAGAAATCAGAGATGG - Intergenic
979574756 4:122276223-122276245 CTTGTCAACAACAACAGACAAGG - Intronic
980644509 4:135625604-135625626 CTGCTCAAAGAAATCAGAGAGGG - Intergenic
981129507 4:141142678-141142700 GTGGTCAACCGCATCAGATATGG - Intronic
981207988 4:142066947-142066969 CTCTTCAAACCCATCAGACAAGG - Intronic
981925729 4:150137426-150137448 ATGGTCAAACTCTTGAGACAAGG + Intronic
982070381 4:151689064-151689086 CAGGTTACACACAGCAGACACGG - Intronic
982355300 4:154460420-154460442 GAGGTCAAACAGATCATACATGG - Intronic
984071296 4:175116524-175116546 CTGCTCAAAGAAATCAGAGATGG + Intergenic
984430018 4:179637134-179637156 CTCGTCAAAGCTATCAGACAGGG - Intergenic
986030189 5:3886270-3886292 CTGGTCAAACAAATAAAAGAGGG - Intergenic
987968514 5:24909531-24909553 CTGGTCAAACACATATAGCATGG - Intergenic
989266251 5:39477355-39477377 CTGGTCAAAAACACCACACTAGG + Intergenic
989324089 5:40170189-40170211 CTGCTCAAAGAAATCAGAGAAGG + Intergenic
989993632 5:50800423-50800445 CTAGTCAAGCACATTAGATAAGG - Intronic
990852814 5:60226392-60226414 CTGCTCAAATAAATCAAACAGGG + Intronic
992194672 5:74327426-74327448 TTGATAAAACTCATCAGACAGGG + Intergenic
992229202 5:74646985-74647007 CTGCCAAAACACATCACACATGG + Intronic
993809214 5:92455040-92455062 CAGGTGAAACACATCAGTTAAGG - Intergenic
995664410 5:114525082-114525104 CTGTTCAAGTAAATCAGACATGG + Intergenic
996252916 5:121359478-121359500 CTAGCCAAACAGATCAGACTAGG - Intergenic
997017787 5:129957125-129957147 CTGTTCAAAGAAATCAGAGATGG - Intronic
997075131 5:130665499-130665521 CTGCTCAAAGAAATCAGAGATGG - Intergenic
997274994 5:132578113-132578135 CTGGTAAAAAAAATCAGAGATGG - Intronic
998009616 5:138684195-138684217 CTCTTCAAAGCCATCAGACAGGG + Intronic
998420525 5:141980868-141980890 CTAGTCAAACACATGTGCCATGG - Intronic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
1002400547 5:178989395-178989417 CTGGTCAAATCCTACAGACAGGG + Exonic
1002760010 6:194176-194198 CAGGACAAACACATCAAACTAGG - Intergenic
1003435412 6:6083532-6083554 CTGTTCAAATTCATCAGAAAAGG - Intergenic
1003902261 6:10665516-10665538 CTGCTCAAAGAAATCAGAGAGGG - Intergenic
1006861839 6:37176909-37176931 TTTGTCAAACACATCAGAGGGGG - Intergenic
1007783355 6:44266534-44266556 CTGGTCAACCCCAGCAGTCAAGG + Intergenic
1009516092 6:64620007-64620029 TTGGTCAAAGACAACAAACAAGG + Intronic
1010682722 6:78815908-78815930 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1012590664 6:100976167-100976189 CTGCTCAAATAAATCAGAGAGGG + Intergenic
1012616513 6:101284639-101284661 GTGGTCCTGCACATCAGACAGGG + Intergenic
1013421990 6:109975618-109975640 CTGATTAAACACTTCACACAAGG + Intergenic
1014183368 6:118408501-118408523 GTGGTCTTTCACATCAGACAAGG + Intergenic
1015247945 6:131096043-131096065 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1016087348 6:139930072-139930094 CCGGTTAAACACATCAGTCAAGG + Intergenic
1016781004 6:147958305-147958327 CTGGTCACCCACAACAGACTTGG - Intergenic
1021865592 7:24953604-24953626 GTGATCAAACAGTTCAGACAGGG + Intronic
1023317957 7:38960123-38960145 CTGGTCAAAGAAATCAGAGATGG + Intergenic
1026730877 7:72910841-72910863 CTGCTCTAACAGATAAGACAGGG + Intronic
1027329278 7:77074554-77074576 TTGTTCAAACACTTAAGACATGG - Intergenic
1030806580 7:113927579-113927601 CTGCTCAAAGAAATCAGAGATGG - Intronic
1031383361 7:121115471-121115493 CTGGTCAATCACAAAAGAAAAGG - Intronic
1036568642 8:9960253-9960275 CAGGTCAAACAGGTCAGACCTGG - Intergenic
1036799161 8:11776954-11776976 CTGGTCAGACACAGCAGCCAGGG - Intronic
1038757465 8:30354851-30354873 CATGTAAAACACTTCAGACATGG - Intergenic
1039102304 8:33953728-33953750 CTGCTCAAAGAAATCAGAAATGG - Intergenic
1040533486 8:48285133-48285155 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1040983827 8:53271836-53271858 CTGGCCAAACACAGCCCACATGG + Intergenic
1041767182 8:61431373-61431395 CAGGTTAAACACTTCATACACGG - Intronic
1044086175 8:87944572-87944594 CTCATCAGACACACCAGACAGGG + Intergenic
1045425257 8:102059881-102059903 CTGGTAAAACACAGCTGCCAGGG + Intronic
1050878356 9:10669620-10669642 CTGCTCAAATAAATCAGAGATGG - Intergenic
1052619504 9:30888419-30888441 CTGGTTGATCACATCAGAAAGGG - Intergenic
1053692122 9:40591941-40591963 CTGGTCAAACACACAGGGCATGG + Intergenic
1053845168 9:42228955-42228977 CTGCTCAAATAAATCAGAGAAGG + Intergenic
1054272678 9:63045544-63045566 CTGGTCAAACACACAGGGCATGG - Intergenic
1054303380 9:63392907-63392929 CTGGTCAAACACACAGGGCATGG + Intergenic
1054402160 9:64719417-64719439 CTGGTCAAACACACAGGGCATGG + Intergenic
1054435765 9:65203732-65203754 CTGGTCAAACACACAGGGCATGG + Intergenic
1054494628 9:65817955-65817977 CTGGTCAAACACACAGGGCATGG - Intergenic
1054584100 9:66947150-66947172 CTGCTCAAATAAATCAGAGAAGG - Intergenic
1054924503 9:70576036-70576058 CTGGTAATACAAATGAGACATGG - Intronic
1057193033 9:93097776-93097798 CTGGGAAACCACATCAGGCAGGG + Intronic
1057413246 9:94837903-94837925 CTGGTCATAGCAATCAGACAAGG + Intronic
1057659549 9:96988459-96988481 TTGGTCAATCACAGCATACATGG - Intronic
1058703857 9:107622931-107622953 CTGGCCAAACACAGCAGCAAGGG + Intergenic
1059945690 9:119406206-119406228 CTGGTTAACCACATCAGATAAGG + Intergenic
1060054614 9:120402882-120402904 CTGCTCAAACAGATCAGCCAGGG - Exonic
1060125426 9:121039985-121040007 GTAGTGAAACAAATCAGACATGG + Intronic
1060590086 9:124811002-124811024 CTGGCCAAAGACAAGAGACAAGG - Exonic
1203622783 Un_KI270749v1:138078-138100 CTGGTCAAACACACAGGGCATGG + Intergenic
1186912991 X:14189610-14189632 CTGGCCAGAAAAATCAGACAAGG - Intergenic
1187630317 X:21162243-21162265 GTGGTCAGATCCATCAGACAGGG - Intergenic
1191654961 X:63586268-63586290 GTGGTCATGCACATCAGACAGGG - Intergenic
1191747472 X:64505327-64505349 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1191777629 X:64833864-64833886 CTGCTCAAATAAATCAGAGATGG - Intergenic
1192955862 X:76069413-76069435 CTGTTCAAAGCTATCAGACAGGG - Intergenic
1193261204 X:79408290-79408312 CTGCTCAAAGAAATCAGAGAGGG + Intergenic
1194154054 X:90364519-90364541 CTGCTCAAAGAAATCAGAGATGG - Intergenic
1194962746 X:100254519-100254541 CTGCTCAAAGAAATCAGAGATGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1199479111 X:148278189-148278211 CTGTTCAAAGAAATCAGAGATGG + Intergenic
1200500406 Y:3941402-3941424 CTGCTCAAAGAAATCAGAGATGG - Intergenic
1201190740 Y:11440471-11440493 CTGGTCAAACACACAGGACATGG + Intergenic