ID: 1171216452

View in Genome Browser
Species Human (GRCh38)
Location 20:23356129-23356151
Sequence CACACACCCCAAATTGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171216452_1171216458 27 Left 1171216452 20:23356129-23356151 CCATTATCAATTTGGGGTGTGTG No data
Right 1171216458 20:23356179-23356201 TGAGGAAAAGGATTTGAATGGGG No data
1171216452_1171216454 15 Left 1171216452 20:23356129-23356151 CCATTATCAATTTGGGGTGTGTG No data
Right 1171216454 20:23356167-23356189 AGTAATCCTAAGTGAGGAAAAGG No data
1171216452_1171216457 26 Left 1171216452 20:23356129-23356151 CCATTATCAATTTGGGGTGTGTG No data
Right 1171216457 20:23356178-23356200 GTGAGGAAAAGGATTTGAATGGG No data
1171216452_1171216456 25 Left 1171216452 20:23356129-23356151 CCATTATCAATTTGGGGTGTGTG No data
Right 1171216456 20:23356177-23356199 AGTGAGGAAAAGGATTTGAATGG No data
1171216452_1171216453 9 Left 1171216452 20:23356129-23356151 CCATTATCAATTTGGGGTGTGTG No data
Right 1171216453 20:23356161-23356183 CACAGCAGTAATCCTAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171216452 Original CRISPR CACACACCCCAAATTGATAA TGG (reversed) Intergenic
No off target data available for this crispr