ID: 1171219083

View in Genome Browser
Species Human (GRCh38)
Location 20:23377917-23377939
Sequence TAGGATGAAAATGATGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171219081_1171219083 -5 Left 1171219081 20:23377899-23377921 CCAAAAATAAAATTACAATAGGA 0: 1
1: 0
2: 8
3: 87
4: 898
Right 1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG 0: 1
1: 0
2: 3
3: 20
4: 246
1171219079_1171219083 -4 Left 1171219079 20:23377898-23377920 CCCAAAAATAAAATTACAATAGG 0: 1
1: 0
2: 7
3: 86
4: 947
Right 1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG 0: 1
1: 0
2: 3
3: 20
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171219083 Original CRISPR TAGGATGAAAATGATGTGGT AGG Intronic
900849749 1:5133086-5133108 TTGGATGAAAATGATTTTCTAGG + Intergenic
901508021 1:9698810-9698832 TAGGATGATGATGAGATGGTGGG + Intronic
901839998 1:11948197-11948219 AAGGATGAAAATGAGTTAGTCGG + Intronic
902116096 1:14122669-14122691 GATGATGAAAATGATCTGGTAGG - Intergenic
903701169 1:25249192-25249214 AAGTATAAAAATGATGTGTTGGG + Intronic
903842490 1:26253684-26253706 TATGATGAAAAAGATGAGGCCGG - Intronic
904076031 1:27843353-27843375 TCTGATGAAAAAGCTGTGGTTGG + Intronic
904448909 1:30598596-30598618 TGGTATGAAAATGATGTGAAAGG - Intergenic
906268560 1:44455507-44455529 TGGGATGGAAAAAATGTGGTAGG + Intronic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
906879509 1:49575193-49575215 GAGGATGACAATGATGTTTTGGG - Intronic
910472545 1:87570956-87570978 TAGCATTAAAATAATGTAGTTGG + Intergenic
912648252 1:111415376-111415398 TAGGATGAGAATGAAGTGGTAGG - Intronic
913071109 1:115299363-115299385 TAGGAAGAAGTTGTTGTGGTTGG + Intronic
913414976 1:118595235-118595257 TGGCAGGAAAATGATGAGGTTGG - Intergenic
916392531 1:164346181-164346203 AATTATGGAAATGATGTGGTAGG - Intergenic
917187678 1:172379015-172379037 TAGGCTGAAAATGATGAGAATGG + Exonic
917257631 1:173132566-173132588 CATGATGGAAATGATGTGGTGGG + Intergenic
917728656 1:177852210-177852232 TAGAATGAAAATGATTGTGTGGG - Intergenic
920217277 1:204369776-204369798 TAGGATGATAATGAGGTGGAAGG + Intronic
920935324 1:210428217-210428239 TAGGAAAAAAATGATGTGGAAGG - Intronic
921947477 1:220895957-220895979 TAGGATGAAAAGGATCAGGATGG + Intergenic
922175130 1:223190918-223190940 TAAGATGAAAATGAATTGATTGG + Intergenic
923741173 1:236656491-236656513 TTGAATGCAAATGATGTGGCTGG + Intergenic
924165219 1:241274208-241274230 AAAGATGACAAAGATGTGGTGGG - Intronic
1063172004 10:3517453-3517475 TAAGATCAAGATGATGTGGTCGG - Intergenic
1064250858 10:13705480-13705502 TAGGATAAAAATGAGGGGCTGGG - Intronic
1066365593 10:34773082-34773104 TAGGATGAAAATGAGATGCTGGG - Intronic
1068245514 10:54360689-54360711 TAGGATGATGATGATGATGTAGG - Intronic
1070358779 10:75666988-75667010 TAGGATGAAAAGGAAGAGGGTGG + Intronic
1070941223 10:80349584-80349606 TAAGATAAAAGTGATGGGGTAGG + Intronic
1071982491 10:91017780-91017802 TAGGATTAAAATGATGGGTAAGG + Intergenic
1073880027 10:107970342-107970364 GAGGAGGAAAATGATGTGCAGGG + Intergenic
1073938084 10:108659003-108659025 TTGGATGAACAGGATGTGGATGG + Intergenic
1075173184 10:120134737-120134759 TGGGATGGAAATGAGGTAGTGGG - Intergenic
1078196240 11:9139284-9139306 TAGTTTAAAAATGATGTGGAAGG + Exonic
1082752049 11:57029952-57029974 TAGTAAGAACATGTTGTGGTAGG - Intergenic
1083425240 11:62580909-62580931 TAGGATGAAAATGAACTGACAGG - Intronic
1088686464 11:112288388-112288410 TAGGATAGAAGTGATTTGGTGGG + Intergenic
1089624791 11:119744470-119744492 TAGCATGAGATTAATGTGGTTGG + Intergenic
1091609949 12:1997956-1997978 TAGGAGAAAACTGATGTGGAAGG - Exonic
1092185859 12:6477984-6478006 TTGGTTGAAAATGATTTTGTTGG + Intergenic
1092967687 12:13660287-13660309 AGGGAAGAATATGATGTGGTAGG - Intronic
1093879443 12:24387238-24387260 TAGGATGAAACTGATATGTGAGG - Intergenic
1094701993 12:32878960-32878982 TTGGTTGAAAATGATTTTGTTGG - Exonic
1095204858 12:39427954-39427976 TAGAAAGAAAAAGATGTGGCTGG - Intronic
1096407189 12:51352407-51352429 TAATATGAAAATGATAGGGTTGG + Exonic
1097040902 12:56155333-56155355 TAGGATGAAAGCATTGTGGTAGG + Intronic
1097129150 12:56797412-56797434 TGGGAGGAAAATGAGGTGGTGGG + Intergenic
1098492343 12:71096423-71096445 AAGCATGAAAATGAAGTGGTGGG - Intronic
1098970613 12:76851476-76851498 TGTGATGAAAATCATGTGATTGG + Exonic
1099309264 12:80997211-80997233 TAGGATGGTTACGATGTGGTAGG - Intronic
1099951235 12:89306733-89306755 CAGGATCAAAATGGTGGGGTAGG + Intergenic
1101542906 12:105681372-105681394 GAGGATGACAATGATGTTTTGGG - Intergenic
1103250047 12:119491810-119491832 TAGGAGGAAAATGTTGCTGTTGG - Intronic
1105625689 13:22110528-22110550 TAGGAGGAACATGCGGTGGTGGG + Intergenic
1105755925 13:23464293-23464315 AAGGTTGAAAATGATGTCTTGGG + Intergenic
1106668405 13:31878078-31878100 TATAATAAAAATGATGTGGTAGG - Intergenic
1108450473 13:50557602-50557624 GAAGATGAAGATGATGAGGTTGG + Intronic
1108601622 13:51999971-51999993 TAGGAGGAAAATCAGGAGGTGGG - Intronic
1109743179 13:66583244-66583266 TAAAATGAACATGATGTTGTAGG - Intronic
1111882302 13:93972682-93972704 TAGAAGGAAAATGATGCAGTAGG - Intronic
1112977913 13:105343749-105343771 TAGGATGAAAGTGAAATGATTGG - Intergenic
1113027935 13:105961718-105961740 CAGGATGAAAAGGATGTGGTGGG - Intergenic
1114080664 14:19199702-19199724 TTGGATGAAAATGTTAGGGTGGG + Intergenic
1117330816 14:54710244-54710266 GATGATAAAAATGATGTGTTTGG + Intronic
1117679271 14:58186661-58186683 AAAGAAGAAACTGATGTGGTTGG + Intronic
1118729869 14:68658703-68658725 GAGGATGATGATGATCTGGTGGG - Intronic
1119834851 14:77739724-77739746 TAGGCTGACACTGATGTGGTAGG + Intronic
1120148232 14:81003186-81003208 TAGAATGAAAATGAAGTAGAAGG - Intronic
1120151162 14:81035647-81035669 AATTATGGAAATGATGTGGTAGG - Intronic
1120508122 14:85378606-85378628 AAGGTAGAAAATGATGGGGTTGG - Intergenic
1122395146 14:101421722-101421744 TAGGAAGAATTTTATGTGGTTGG - Intergenic
1124986147 15:34617505-34617527 TAGGATGAAAATGCTGAGAGAGG - Intergenic
1125156354 15:36591047-36591069 CAGGGTGAAAATTTTGTGGTTGG + Intronic
1126930187 15:53639168-53639190 TATGAAGGAAAGGATGTGGTAGG - Intronic
1126950239 15:53872825-53872847 TATAATGAAATTGATGTTGTTGG + Intergenic
1126971380 15:54116034-54116056 TATAATTAAAATGATGTGGATGG - Intronic
1127023599 15:54778487-54778509 TGAGATTAAAATGGTGTGGTTGG - Intergenic
1127299084 15:57634932-57634954 TAGGAGGACAATAATGTGGGAGG - Intronic
1130901606 15:88210944-88210966 TTGAATGAAAATGGTGTGCTGGG - Intronic
1131567283 15:93497883-93497905 ATGGATGAACATGCTGTGGTAGG + Intergenic
1133549402 16:6839278-6839300 TATGTTGAAAATGATGTGCCGGG - Intronic
1135289485 16:21223088-21223110 TAGGATGTAACTGATGTGAGAGG + Intergenic
1137571617 16:49569909-49569931 GAGGAGGAAATTGATGTGGCAGG + Intronic
1137609428 16:49809031-49809053 TGGGATGAGACAGATGTGGTTGG - Intronic
1137972638 16:53001084-53001106 AAGGAGGAAAAATATGTGGTAGG + Intergenic
1138220582 16:55246984-55247006 GAGGATGATACTTATGTGGTAGG + Intergenic
1138897811 16:61229927-61229949 TATGAAGAAAATTATTTGGTAGG + Intergenic
1140820339 16:78657314-78657336 TGGGAAGAAAATGAGGTGGGGGG + Intronic
1141511430 16:84514566-84514588 TGGGATGAAAATAATGGGGGTGG + Intronic
1141571213 16:84934650-84934672 CAGGATGAAATTCAGGTGGTGGG - Intergenic
1141739906 16:85884213-85884235 TAGGGTGAATTGGATGTGGTGGG + Intergenic
1142942567 17:3394970-3394992 AAGGATGAAAGTGATGGGCTTGG + Intergenic
1144023550 17:11258160-11258182 TAGGAAGAAAATGATGCTGTTGG - Intronic
1146241690 17:31234782-31234804 AAGGATTACAATAATGTGGTAGG - Intronic
1146385798 17:32371998-32372020 TAAGATAAAAATGGTGTGATAGG + Exonic
1146696674 17:34913871-34913893 GAGGATGAAAATTATGTGCCCGG + Intergenic
1147432528 17:40381578-40381600 GAGCATGAATTTGATGTGGTTGG + Intergenic
1147836668 17:43337739-43337761 CTGGATGAAAAGGATCTGGTTGG + Intergenic
1148000016 17:44382185-44382207 TAGGTTGAAAATGATGTTGTGGG - Intronic
1151222423 17:72622977-72622999 TGGGATGAAACTGATGAGGATGG + Intergenic
1152098271 17:78285621-78285643 GATGATGAAAATGTTCTGGTAGG + Intergenic
1152863026 17:82706709-82706731 CAGGACGTAAATGATGTTGTAGG - Intergenic
1154257290 18:12794573-12794595 TAGGGTGAAAACTATGTGGATGG - Intronic
1155787021 18:29914233-29914255 TGGGATCACAATGATGAGGTGGG + Intergenic
1155995478 18:32326735-32326757 TTGGATGAAAATGAAGTATTGGG - Intronic
1156640442 18:39089023-39089045 TATGATGAAAAAGATGTGTGGGG + Intergenic
1160502645 18:79410049-79410071 TCGGATGAAGATGGGGTGGTTGG + Intronic
1161388918 19:4011274-4011296 TGGGATGAATGAGATGTGGTGGG - Intronic
1163413421 19:17171262-17171284 CAGGAGGGAAATGATGTTGTTGG - Intronic
1164111509 19:22164043-22164065 TAGAATAAAAATGATGGAGTTGG + Intergenic
1167910430 19:52697729-52697751 TAGTATGAAAGTGAAGCGGTGGG + Intergenic
926816740 2:16805043-16805065 TAGGAGGAAAATGGTTTCGTGGG - Intergenic
929153992 2:38773206-38773228 AAGCATGAAAATGCTTTGGTTGG - Intronic
929184065 2:39074903-39074925 TAAGAACAAAATGATGTGTTGGG + Intronic
929505654 2:42525958-42525980 TAGGTTGAAACTGAAGTGCTAGG - Intronic
929888939 2:45903810-45903832 TATGATGAAAGTGATGAGGTGGG - Intronic
931531542 2:63220369-63220391 TAGGCTGAATATTAGGTGGTTGG + Intronic
932291369 2:70582857-70582879 TAAGATGAAAGTGAAGGGGTAGG + Intergenic
932385291 2:71326773-71326795 TAGGGGGAAAATGATGAGGCAGG - Intronic
935281053 2:101518251-101518273 TGGGATAAGAATGATGTGCTGGG - Intergenic
937391213 2:121488327-121488349 TAGGATGAGATTGATGTGCCAGG + Intronic
939096881 2:137842425-137842447 GAGGCTGAAACTGATTTGGTAGG + Intergenic
939600794 2:144187742-144187764 TGGGATGATGATGATGTAGTGGG + Intronic
940348496 2:152653633-152653655 TATGCTGAAAAAAATGTGGTGGG + Exonic
941424777 2:165328720-165328742 TAGGATGGAAAGGATGTTCTAGG + Intronic
942841105 2:180361545-180361567 TAGGCTGAAAAAGGTGTAGTGGG + Intergenic
943813792 2:192225016-192225038 TGGGCTGAAAATGAAGTGGTGGG - Intergenic
944275075 2:197827169-197827191 AAGGAAGAAAATGATGCAGTTGG - Intronic
944461216 2:199953019-199953041 TTGGGTGAAAATGATGTGCCAGG + Intronic
944924544 2:204451055-204451077 TGGGCTGAAAATGATGGGATAGG - Intergenic
945142842 2:206705479-206705501 TAGGAAGAAGATCATGAGGTTGG + Intronic
945258874 2:207825833-207825855 TAAGCAGAAAATGATGTGGGTGG + Intergenic
946596937 2:221316160-221316182 TAGGAGGAAAATGGAGTTGTGGG + Intergenic
1168865748 20:1084980-1085002 AAGGATGGAAAAGATGTGTTAGG - Intergenic
1170370102 20:15639260-15639282 TTTGATGAAAATGAAATGGTAGG + Intronic
1170879549 20:20284038-20284060 AAGGATAAAAAGCATGTGGTAGG - Intronic
1171219083 20:23377917-23377939 TAGGATGAAAATGATGTGGTAGG + Intronic
1171255084 20:23684458-23684480 CAGGAGGAGAATGATCTGGTAGG - Intergenic
1177054006 21:16276812-16276834 TGTGATGAAAATGATGATGTTGG + Intergenic
1177208763 21:18043675-18043697 TAGGCTGAAAATGATGACATGGG + Intronic
1180500110 22:15922983-15923005 TTGGATGAAAATGTTAGGGTGGG - Intergenic
1181715932 22:24728759-24728781 TAGGATGGAAATGATATTGCAGG - Intronic
1182098842 22:27643815-27643837 GAGGATGGAAAGGAGGTGGTGGG + Intergenic
1183040718 22:35175782-35175804 GAGGATGAAAATAAAGTGGAGGG - Intergenic
949323050 3:2833088-2833110 TAGAATGAAAATGCTTTGGAAGG + Intronic
950097209 3:10337258-10337280 TCGGATGGAAATGAGGTGCTGGG + Intronic
952204798 3:31170556-31170578 TATGATGAAAAAGATGTTCTAGG + Intergenic
953367190 3:42354850-42354872 AAGGATGAAAAGGAGGAGGTGGG - Intergenic
953809835 3:46102845-46102867 TAGGCTGGAAATCAAGTGGTGGG - Intergenic
955153055 3:56388067-56388089 TATTATGAAAATGATGAGTTAGG - Intronic
957548395 3:81670440-81670462 TCGGGTGAAATTGATGTGGGAGG - Intronic
958567516 3:95833969-95833991 TATCATGAAAATGATATTGTAGG + Intergenic
958673834 3:97239898-97239920 TAGGCTGAATATGATGTAATAGG + Intronic
961937150 3:130597362-130597384 TGGGATGAAAAAGATGGGTTTGG - Intronic
963055679 3:141184672-141184694 CAGGATTAAAATGATGTCATTGG + Intergenic
963296201 3:143549447-143549469 AGGGATGAAAATGAAGTGGAAGG + Intronic
964030593 3:152134798-152134820 TAGGATTAAAATGATTGGGATGG - Intergenic
964236836 3:154541185-154541207 AGGGATGAAAATCATGTTGTGGG + Intergenic
965806860 3:172550980-172551002 GAGGAGGAAAATGAAGAGGTGGG - Intergenic
967364513 3:188670674-188670696 TTGGATTAAACTCATGTGGTTGG + Intronic
970830268 4:20330379-20330401 TTAGGTGATAATGATGTGGTCGG + Intronic
971603481 4:28626198-28626220 TAAGATGAAAATACTGTGGATGG - Intergenic
971612067 4:28738250-28738272 TAGGAAGAAAATGATGTAAATGG + Intergenic
971689581 4:29815584-29815606 TAAGATGAAGAAGATGTGGCTGG - Intergenic
973658465 4:53076593-53076615 TAAGAGGAAAATGAGGTGGACGG + Intronic
973917188 4:55647231-55647253 TAGAGTAATAATGATGTGGTGGG - Intergenic
974144764 4:57933437-57933459 AAGAATGAAGATGGTGTGGTGGG + Intergenic
974378068 4:61103500-61103522 TAGAATGAAATTGATGAGTTAGG - Intergenic
975056635 4:69940950-69940972 TCATATGAAAATGATGGGGTTGG + Intronic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
978165760 4:105604407-105604429 AAGGCTCAAAAAGATGTGGTGGG - Intronic
980699999 4:136413442-136413464 TAGAAAGAAAATGTTATGGTAGG + Intergenic
981214967 4:142153756-142153778 TAGGATGTATAAGATGTGTTAGG + Intronic
981655759 4:147110906-147110928 TAGCATGCAAATGATGGGGCTGG + Intergenic
983007869 4:162507564-162507586 TAGGAGATAAAGGATGTGGTAGG - Intergenic
983436260 4:167719752-167719774 TATGATGGAAATTATGTGGAGGG - Intergenic
985093752 4:186391559-186391581 GTGAATGAAAATTATGTGGTTGG + Intergenic
986262016 5:6155857-6155879 TAGGAGGGAAATGATGGAGTTGG - Intergenic
986384138 5:7215120-7215142 TAGGATGATAATGATGTTGATGG - Intergenic
988395377 5:30691136-30691158 TAGAAGGGAAATGATGTGGGCGG - Intergenic
989374234 5:40743380-40743402 TAAGATGAAGTTGATTTGGTAGG + Intronic
994794978 5:104285927-104285949 TAGGATAGAAATGATGTTATAGG - Intergenic
995930529 5:117437000-117437022 TAGGATGCAGAGGATGGGGTAGG + Intergenic
996905986 5:128600880-128600902 TAGGATGATAGTTATGTAGTAGG - Intronic
997711044 5:136005163-136005185 AATGATGAAAATGATGAGGAAGG - Intergenic
997963804 5:138342021-138342043 TAGCATGAAAGTTATCTGGTTGG + Intronic
998204664 5:140149946-140149968 TAGGATGAGACTGATGAGGGTGG + Intergenic
1000597261 5:163230244-163230266 TAGTATAAAAAAGCTGTGGTAGG - Intergenic
1001201862 5:169724826-169724848 TAGGAAGAAACTGAGCTGGTGGG - Intronic
1001208212 5:169784357-169784379 TGGGCTGAAAATGAAGAGGTTGG - Intronic
1003354643 6:5355805-5355827 AAGGAAGAGAATGATGTGGCTGG - Intronic
1003385292 6:5661723-5661745 TGGGTTGAAAATGAAGTGGGAGG + Intronic
1004416979 6:15433697-15433719 TATGATGCAATTGATGTGGGTGG - Intronic
1005215827 6:23527084-23527106 GAGGAAGAAAATGTAGTGGTTGG + Intergenic
1005809427 6:29504939-29504961 TTAGATGAAGATGTTGTGGTGGG - Intergenic
1007154807 6:39732217-39732239 CAGGATGAATAAGGTGTGGTTGG - Intergenic
1007186148 6:39973964-39973986 AAGTATAAAGATGATGTGGTAGG - Intergenic
1008508222 6:52251819-52251841 TCAGATGAAAATGCTGTGCTAGG + Intergenic
1008597495 6:53057451-53057473 TAGGATGACAATCATCTGCTAGG + Intronic
1009782696 6:68290934-68290956 CAGTGTGAAAATGAGGTGGTGGG - Intergenic
1010022091 6:71172183-71172205 TAGGTTGATTATGTTGTGGTTGG + Intergenic
1011266428 6:85524345-85524367 TAGGATGAAAATGTAGTGATAGG + Intronic
1011344541 6:86354354-86354376 TAGCAGGAAGGTGATGTGGTGGG + Intergenic
1011487677 6:87859932-87859954 TAGGAAGAAAATGATGAAGGTGG + Intergenic
1013291510 6:108723130-108723152 GAGGATGAAGATAAAGTGGTAGG - Intergenic
1013832696 6:114293393-114293415 GAGGTTGAAAAGGATTTGGTGGG + Intronic
1014084353 6:117325957-117325979 GAGCATGGAATTGATGTGGTAGG + Intronic
1014408868 6:121089045-121089067 TAGGAAGAAAAATAAGTGGTAGG + Intronic
1014541087 6:122677503-122677525 AAGAATGAAAATGATGAGTTTGG + Intronic
1014643801 6:123948271-123948293 TTGGATAAAAATGAAGTAGTGGG + Intronic
1018382863 6:163275356-163275378 TAAGATGAAAACAATGTGGGTGG - Intronic
1019975443 7:4577639-4577661 TAGAATGAAAAAGAGTTGGTTGG - Intergenic
1020541878 7:9469045-9469067 TAGGTTGAATAGGTTGTGGTGGG - Intergenic
1021370441 7:19838628-19838650 CAGGTTGAAAATGAGGTGTTAGG - Intergenic
1021771965 7:24012593-24012615 TAGGCTGAAAATGAAGGGATGGG + Intergenic
1022059410 7:26776459-26776481 TAGGAAGGAAAGGAGGTGGTTGG - Intronic
1022743333 7:33144210-33144232 TTGGCTGTAAATAATGTGGTGGG - Intronic
1023481404 7:40638711-40638733 TATTAGGAAAATGATGTAGTAGG + Intronic
1024908184 7:54412615-54412637 TAGGCTGAAACTGAAGTGATGGG + Intergenic
1028021198 7:85775965-85775987 TATGATGAAAATAATATTGTGGG - Intergenic
1029470072 7:100748724-100748746 TAGACTGAAAATGAGGTGGTGGG - Intronic
1030472981 7:109990846-109990868 TAGCCTGAAAATGATTTGTTGGG + Intergenic
1030688678 7:112510971-112510993 AAAGAGGAAAATGATGTGGGTGG + Intergenic
1031717997 7:125132812-125132834 TAGGAAGAAAAAGATTTTGTTGG - Intergenic
1034390208 7:150781142-150781164 TTGGTTGAAATTGTTGTGGTGGG - Intergenic
1036403205 8:8429216-8429238 GACGATAAAAATGATGTTGTTGG - Intergenic
1036939297 8:13036211-13036233 TAGGATGAAAAGAATTTGCTTGG + Intergenic
1037035740 8:14164320-14164342 GGGGAAGAAAATGATGTGGCTGG - Intronic
1037557060 8:20034920-20034942 TAGGATGGAAATGAGGAGGAGGG + Intergenic
1037638604 8:20722523-20722545 TGGGCTGAGAATGAAGTGGTAGG + Intergenic
1040766023 8:50912454-50912476 TAGGCTGAAAATGATCTGTGGGG - Intergenic
1041925058 8:63228118-63228140 AAGGAAGAAACTGATGTGGTTGG + Intergenic
1042801658 8:72724524-72724546 TATCATGAAAATGATATGGCCGG - Intronic
1044150279 8:88768052-88768074 TAGAATGAAAAAGATGAGGCTGG + Intergenic
1044463410 8:92474962-92474984 GAGGCTCAAAATGATGTGGCTGG - Intergenic
1046410443 8:113834995-113835017 TAGGATGAAGCTTAAGTGGTAGG - Intergenic
1047306162 8:123654671-123654693 AATGATGATAGTGATGTGGTAGG + Intergenic
1047882781 8:129215024-129215046 TAGATTGAAAATGCTGTGGAAGG + Intergenic
1050574570 9:6979958-6979980 TAGGATGAGAACTCTGTGGTGGG + Intronic
1051274322 9:15384370-15384392 TAGAATTAAAATGATGAGGCCGG + Intergenic
1051860342 9:21617392-21617414 CAGGATGAGAATGATGGGGGCGG + Intergenic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1052615400 9:30833011-30833033 TATAATGAAAATGAGGTGGTAGG - Intergenic
1053667564 9:40326824-40326846 TAGGCTGAAAATGAAGGGGGAGG - Intronic
1053917147 9:42951927-42951949 TAGGCTGAAAATGAAGGGGGAGG - Intergenic
1054378707 9:64466851-64466873 TAGGCTGAAAATGAAGGGGGAGG - Intergenic
1054517047 9:66049461-66049483 TAGGCTGAAAATGAAGGGGGAGG + Intergenic
1054901088 9:70370439-70370461 AACAATGAAAATGTTGTGGTCGG + Intergenic
1055126421 9:72723428-72723450 TAGAATGAAAATGATGAAGCAGG - Intronic
1057725014 9:97562293-97562315 TAGGATGGAGATGATGGGATGGG + Intronic
1058924955 9:109654220-109654242 TAATATGAATATGATGTGTTAGG + Intronic
1059874859 9:118623246-118623268 TAGGGTGAGAATGGGGTGGTGGG - Intergenic
1060008311 9:120020041-120020063 TATGATGGAAATATTGTGGTTGG + Intergenic
1060961259 9:127682462-127682484 AAGGATGAAAATGATGAGGCGGG - Exonic
1061348416 9:130044286-130044308 CAGGTTGAAAATGGTGGGGTGGG - Intergenic
1186167070 X:6837974-6837996 CAGAATGTAAATGATGTGCTAGG + Intergenic
1186437581 X:9556260-9556282 TATGATGAGAATGCAGTGGTGGG + Intronic
1188386357 X:29564403-29564425 AATGAGGAAAATGATGTGGCAGG + Intronic
1191720805 X:64226905-64226927 TAGAAAGAAAATTATGAGGTGGG + Intronic
1192399159 X:70817053-70817075 TAGGATGAATATTTTGTTGTTGG + Intronic
1192852623 X:74973594-74973616 TAGGATGTAAAGGGTATGGTAGG - Intergenic
1195726461 X:107922543-107922565 CAGGATTAAAAGGATGTGGGAGG - Intronic
1196393179 X:115231257-115231279 TTTGATGAAAATGATCTGTTTGG - Intronic
1198332971 X:135638936-135638958 TGGAAAGAAAATGAAGTGGTTGG + Intergenic
1198782583 X:140253901-140253923 TAGGGAGTAAATGATGTGGGTGG + Intergenic
1201921089 Y:19233749-19233771 TTGGATCACAATGATGTGATGGG + Intergenic
1202374336 Y:24219637-24219659 GAGGATGAAAATGGTTTTGTAGG - Intergenic
1202496445 Y:25450483-25450505 GAGGATGAAAATGGTTTTGTAGG + Intergenic