ID: 1171220028

View in Genome Browser
Species Human (GRCh38)
Location 20:23387859-23387881
Sequence CAGAATAACACCAAATATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1331
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 1275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171220028_1171220031 -9 Left 1171220028 20:23387859-23387881 CCCAGATATTTGGTGTTATTCTG 0: 1
1: 0
2: 1
3: 54
4: 1275
Right 1171220031 20:23387873-23387895 GTTATTCTGAGTGTGTCTGTGGG 0: 1
1: 2
2: 9
3: 49
4: 341
1171220028_1171220030 -10 Left 1171220028 20:23387859-23387881 CCCAGATATTTGGTGTTATTCTG 0: 1
1: 0
2: 1
3: 54
4: 1275
Right 1171220030 20:23387872-23387894 TGTTATTCTGAGTGTGTCTGTGG 0: 1
1: 1
2: 9
3: 43
4: 386
1171220028_1171220032 -8 Left 1171220028 20:23387859-23387881 CCCAGATATTTGGTGTTATTCTG 0: 1
1: 0
2: 1
3: 54
4: 1275
Right 1171220032 20:23387874-23387896 TTATTCTGAGTGTGTCTGTGGGG 0: 6
1: 112
2: 454
3: 2010
4: 3514
1171220028_1171220033 27 Left 1171220028 20:23387859-23387881 CCCAGATATTTGGTGTTATTCTG 0: 1
1: 0
2: 1
3: 54
4: 1275
Right 1171220033 20:23387909-23387931 AGATTAACGTTTGCATCAGTAGG 0: 1
1: 6
2: 91
3: 1149
4: 991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171220028 Original CRISPR CAGAATAACACCAAATATCT GGG (reversed) Intronic
902144474 1:14386672-14386694 CAGACTAACAGCGGATATCTCGG - Intergenic
903116443 1:21182361-21182383 CAGGGTAACACCAAATCTTTAGG - Intergenic
904931859 1:34094041-34094063 CAGACTAACAGCAGATCTCTCGG + Intronic
904952282 1:34252387-34252409 CAGACTAACAGCAGATCTCTTGG + Intergenic
905525265 1:38633528-38633550 CAGACTAACAGCAGATCTCTCGG - Intergenic
905963022 1:42061012-42061034 CAGACTAACAGCAGATCTCTCGG + Intergenic
905993502 1:42360500-42360522 CATAAGAACAATAAATATCTTGG - Intergenic
906356758 1:45113723-45113745 AAGAATAACTCCAAAAATCTAGG + Intronic
906410219 1:45572943-45572965 ACAAATAAAACCAAATATCTAGG - Intergenic
906839381 1:49120553-49120575 CAGACTAACAGCAGATCTCTCGG - Intronic
907863570 1:58377538-58377560 CAGACTAACAGCAGATCTCTTGG - Intronic
907991681 1:59588572-59588594 CAGACTAACAGCAGATCTCTTGG + Intronic
908178222 1:61577734-61577756 CAGACTAACAGCAGATCTCTTGG - Intergenic
908413193 1:63886922-63886944 CAGAAAAACATCATATATCCAGG - Intronic
908639163 1:66203206-66203228 CAGAGTAACAGCAGATCTCTCGG - Intronic
908691206 1:66781948-66781970 CAGACTAACAGCAGATCTCTCGG + Intergenic
908744891 1:67366982-67367004 CAAAATAACACTAAATTTCAAGG + Intronic
908813371 1:68007439-68007461 CAGACTAACAGCAGATCTCTGGG - Intergenic
908881485 1:68738468-68738490 CAGACTAACAGCAGATCTCTCGG - Intergenic
908898269 1:68925134-68925156 CAGACTAACAGCAGATCTCTCGG + Intergenic
908903194 1:68979674-68979696 CAGAGTAAAACCTAAAATCTGGG - Intergenic
909036452 1:70599481-70599503 CAGACTAACAGCAGATCTCTTGG - Intergenic
909136907 1:71812795-71812817 CTGAATAAGATCTAATATCTGGG - Intronic
909325914 1:74351325-74351347 CAGACTAACAGCAGATCTCTCGG - Intronic
909440783 1:75693280-75693302 CAGAATATAACCCAATATTTAGG - Intergenic
909552379 1:76913277-76913299 CAGACTAACAGCAGATCTCTTGG - Intronic
909560386 1:77003850-77003872 CAGACTAACAGCAGATCTCTCGG - Intronic
909570795 1:77108448-77108470 CAGACTAACAGCAGATCTCTCGG - Intronic
909756328 1:79230646-79230668 CAGAATAACAGCAATTTTCAGGG + Intergenic
909770545 1:79415924-79415946 CAGACTAACAGCAGATCTCTTGG + Intergenic
909886410 1:80947169-80947191 CAGACTAACAGCAGATCTCTCGG + Intergenic
910284121 1:85534531-85534553 CAGAAAAATAACTAATATCTTGG - Intronic
910385960 1:86683444-86683466 CAGACTAACAGCAGATCTCTCGG - Intergenic
910636708 1:89416945-89416967 CAGACTAACAGCAGATCTCTCGG - Intergenic
910807713 1:91205182-91205204 GAGAATAAAACAAAATAACTGGG + Intergenic
910829295 1:91443615-91443637 CAGACTAACAGCAGATCTCTCGG + Intergenic
910911225 1:92236467-92236489 CAGACTAACAGCAGATCTCTAGG - Intronic
911079523 1:93914950-93914972 CAGACTAACAACAGATCTCTTGG - Intergenic
911673778 1:100636595-100636617 CAGACTAACAGCAGATCTCTCGG - Intergenic
911676746 1:100667337-100667359 CAGACTAACAGCAGATCTCTTGG - Intergenic
912009285 1:104939504-104939526 CAGACTAACAGCAGATCTCTCGG - Intergenic
912737021 1:112159159-112159181 CAGACTAACAGCAGATCTCTCGG - Intergenic
912888252 1:113498846-113498868 CAGACTAACAGCAGATCTCTCGG + Intronic
913410387 1:118544297-118544319 CAGACTAACAGCAGATCTCTTGG + Intergenic
913412877 1:118572584-118572606 CAGACTAACAGCAGATCTCTCGG - Intergenic
913434573 1:118833204-118833226 CAGACTAACAGCAGATCTCTCGG + Intergenic
913479346 1:119271928-119271950 TAAAAGAACATCAAATATCTAGG + Intergenic
913990102 1:143603449-143603471 CAGACTAACAGCAGATCTCTTGG + Intergenic
914142846 1:144966274-144966296 CAGACTAACAGCAAATCTCTCGG + Intronic
914205900 1:145528450-145528472 CAGAAAAATAACTAATATCTTGG + Intergenic
914214966 1:145617332-145617354 CAGAATAACAGCAATTTTCAGGG - Intronic
914388378 1:147194866-147194888 CAGACTAACAGCAGATCTCTCGG - Intronic
914466912 1:147937726-147937748 CAGAATAACAGCAATTTTCAGGG - Intronic
914683294 1:149956393-149956415 CAGACTAACAGCAGATCTCTCGG - Intronic
914983350 1:152435573-152435595 CAGACTAACAGCAGATCTCTCGG - Intergenic
915077166 1:153318649-153318671 CAGACTAACAGCAGATCTCTCGG - Intergenic
915799607 1:158776042-158776064 AAGAATAACTCCGAGTATCTAGG + Intergenic
915885098 1:159713616-159713638 GAGATTAACACCATCTATCTTGG - Exonic
915992074 1:160528306-160528328 CAGACTAACAGCAGATCTCTTGG - Intergenic
916122015 1:161537059-161537081 CAGAATAACAGCAATTTTCAGGG + Intergenic
916131906 1:161618484-161618506 CAGAATAACAGCAATTTTCAGGG + Intronic
916402206 1:164460849-164460871 CAGACTAACAGCAGATCTCTCGG + Intergenic
917366916 1:174241523-174241545 CAGAATAACACCTTATAGATTGG - Exonic
917398452 1:174619422-174619444 CAGACTAACAGCAGATCTCTCGG + Intronic
917419422 1:174847586-174847608 CAGACTAACAGCAGATCTCTCGG - Intronic
917768390 1:178248897-178248919 CAGACTAACAGCAGATTTCTTGG - Intronic
917805781 1:178612386-178612408 AAGAATAACACCAAATTTTGTGG - Intergenic
918517869 1:185382956-185382978 CAGACTAACAGCAGATCTCTCGG - Intergenic
918977783 1:191513047-191513069 CAGAATAACAGCAATTTTCAGGG + Intergenic
919284081 1:195530877-195530899 AAAAATAAAACTAAATATCTAGG + Intergenic
919332710 1:196191932-196191954 CAGACTAACAGCAGATCTCTCGG - Intergenic
919519110 1:198565138-198565160 CAGAAAAACAACATATATATTGG - Intergenic
919538167 1:198814201-198814223 CAGAATAACAGCAATTTTCAGGG - Intergenic
919869024 1:201806405-201806427 CCACATAACACCAAACATCTCGG + Intronic
920392017 1:205612215-205612237 CTGAAAAACTCCAAATCTCTAGG + Exonic
920993549 1:210964075-210964097 CAGACTAACAGCAGATCTCTCGG + Intronic
921043355 1:211455147-211455169 CAGACTAACAGCAGATCTCTTGG + Intergenic
921306983 1:213807138-213807160 CAGACTAACAGCAGATCTCTCGG - Intergenic
921407364 1:214795601-214795623 AAAAATAAAACAAAATATCTGGG - Intergenic
922051978 1:221999757-221999779 CAGAATAACAACAAAAATCTAGG - Intergenic
922206205 1:223448637-223448659 CAGACTAACAGCAGATCTCTCGG + Intergenic
922393310 1:225169902-225169924 CAGACTAACAGCAGATCTCTTGG + Intronic
922409154 1:225353450-225353472 CAGAAAAACACCACATATACAGG + Intronic
922676122 1:227551495-227551517 CAGAATAACAGCAGATCTCTCGG + Intergenic
922848326 1:228708441-228708463 CAGACTAACAGCAGATCTCTCGG + Intergenic
923402697 1:233630048-233630070 CAGAAGAACACCTGATGTCTGGG - Intronic
923776370 1:236982165-236982187 TACAAAAACACCAAGTATCTGGG + Intergenic
924296885 1:242596829-242596851 CAGAATAACAGCAAATTTTAGGG + Intergenic
924889106 1:248254499-248254521 CAGACTAACAGCAGATCTCTCGG + Intergenic
924935331 1:248763410-248763432 CAGACTAACAGCAGATCTCTCGG + Intergenic
1063339244 10:5247000-5247022 CAGACTAACAGCAGATCTCTCGG + Intergenic
1063831570 10:9959359-9959381 CAGACTAACAGCAGATCTCTCGG + Intergenic
1065237688 10:23670771-23670793 CAGACTAACAGCAGATCTCTTGG - Intergenic
1065241866 10:23713737-23713759 CAGAATTACATCACATATTTTGG - Intronic
1065342475 10:24721474-24721496 CAGCTCAACTCCAAATATCTCGG + Intronic
1065347388 10:24761763-24761785 TAAAATAAAACAAAATATCTAGG - Intergenic
1065397138 10:25251672-25251694 CAGACTAACAGCAGATCTCTCGG - Intronic
1065488828 10:26261282-26261304 AATAATAACACAAAATTTCTAGG - Intronic
1066059468 10:31709025-31709047 TAGAATCACACCAAATAATTGGG + Intergenic
1066149157 10:32596884-32596906 CAGACTAACAGCAGATGTCTCGG - Intronic
1066205480 10:33185268-33185290 CTGGATAATTCCAAATATCTGGG - Intronic
1066297721 10:34069267-34069289 CAGACTAACAGCAGATGTCTTGG + Intergenic
1066487425 10:35860313-35860335 CAGACTAACAGCAGATCTCTCGG + Intergenic
1066612867 10:37267812-37267834 GAGAAAAACTCCAAATATCATGG - Intronic
1066664361 10:37767407-37767429 CAGACTAACAGCAGATCTCTTGG + Intergenic
1066677077 10:37898617-37898639 CAGACTAACAGCAGATCTCTTGG + Intergenic
1066687822 10:37997081-37997103 CAGACTAACAGCAGATCTCTTGG + Intergenic
1066755384 10:38706625-38706647 CAGACTAACAGCAGATCTCTTGG + Intergenic
1067212358 10:44270086-44270108 CAGACTAACAGCAGATCTCTCGG + Intergenic
1067240410 10:44487175-44487197 CAGACTAACAGCAGATCTCTTGG - Intergenic
1067317106 10:45179148-45179170 AAAAATATCACCAAATATATTGG - Intergenic
1067895163 10:50171115-50171137 CAGACTAACAGCAAACTTCTCGG + Intergenic
1068085047 10:52364553-52364575 CAGACTAACAGCAGATCTCTCGG - Intergenic
1068097191 10:52505731-52505753 CAGAATAACAGCAATTTTCAGGG - Intergenic
1068256393 10:54516843-54516865 CAGAGTAACAGCAGATCTCTCGG + Intronic
1068576080 10:58686223-58686245 CAGACTAACAGCAGATCTCTCGG - Intronic
1069084401 10:64121930-64121952 CAGACTAACAGCAGATCTCTCGG + Intergenic
1069227020 10:65957744-65957766 CAGACTAACAGCAGATCTCTCGG - Intronic
1069260091 10:66383729-66383751 CAGACTAACAGCAGATCTCTTGG + Intronic
1069284242 10:66692745-66692767 CAGACTAACAGCAGATCTCTTGG + Intronic
1069337725 10:67372759-67372781 CAGACTAACAGCAGATCTCTCGG + Intronic
1070007336 10:72437180-72437202 CAGACTAACAGCAGATCTCTCGG + Intronic
1070231459 10:74572362-74572384 CAGACTAACAGCAGATCTCTCGG - Intronic
1070632685 10:78098155-78098177 CAGACTAACAGCAGATCTCTCGG + Intergenic
1070709419 10:78668112-78668134 CAGACTAACAGCAGATCTCTTGG + Intergenic
1071193799 10:83133816-83133838 CAGACTAACAGCGGATATCTCGG - Intergenic
1071386645 10:85127514-85127536 CAGACTAACAGCGAATCTCTCGG + Intergenic
1071763231 10:88632964-88632986 CAGACTAACAGCAGATCTCTCGG - Intergenic
1071825143 10:89317850-89317872 CAGACTAACAGCAGATGTCTCGG + Intronic
1071912577 10:90252260-90252282 CAGACTAACAGCAGATCTCTCGG + Intergenic
1072023640 10:91431238-91431260 CAGACTAACAGCAGATCTCTCGG - Intronic
1072055541 10:91751261-91751283 CAGACTAACAGCAGATCTCTCGG + Intergenic
1072109430 10:92304444-92304466 AAGAATAAAACAAAATATATAGG + Intronic
1072307473 10:94121395-94121417 CAGAATGCTACCAAATAGCTAGG + Intronic
1072370013 10:94756787-94756809 CAGACTAACAGCAGATAACTTGG - Intronic
1073927545 10:108534319-108534341 CAGACTAACAGCAGATCTCTTGG + Intergenic
1074236105 10:111585562-111585584 CAGACTAACAGCAGATCTCTCGG + Intergenic
1074257343 10:111815453-111815475 CAGACTAACAGCAGATCTCTCGG + Intergenic
1074286851 10:112105572-112105594 CAGACTAACAGCAGATCTCTCGG + Intergenic
1074305309 10:112271584-112271606 CAGAAAATCACCAAATAAATTGG + Intergenic
1074934798 10:118167332-118167354 CAGACTAACATCAGCTATCTCGG + Intergenic
1075708244 10:124515840-124515862 AAGAATCACACCAAATAACTAGG - Intronic
1075854471 10:125617645-125617667 CAGACTAACAGCAGATCTCTGGG - Intronic
1075858214 10:125649288-125649310 CAGACTAACAGCAGATCTCTTGG + Intronic
1075859128 10:125659603-125659625 CAGAAGAAAACCAGATTTCTGGG + Intronic
1076339764 10:129736918-129736940 CAGACTAACAGCAGATCTCTTGG - Intronic
1076397631 10:130152659-130152681 CAGACTAACAGCAGATCTCTCGG - Intronic
1077348648 11:2078021-2078043 CCTAAAAACACCAAATTTCTAGG - Intergenic
1077561863 11:3268770-3268792 CAGACTAACAGCAGATCTCTCGG - Intergenic
1077567757 11:3314590-3314612 CAGACTAACAGCAGATCTCTCGG - Intergenic
1077839316 11:5957246-5957268 CAGAAGAATATCAAATATTTAGG + Intergenic
1078036724 11:7813507-7813529 CAGACTAACAGCGGATATCTCGG - Intergenic
1078560580 11:12367725-12367747 CAGACTAACAGCAGATCTCTCGG + Intergenic
1079196745 11:18334786-18334808 CAAAATAATAACTAATATCTAGG - Intronic
1079286379 11:19136702-19136724 CAGACTAACAGCAGATCTCTCGG + Intronic
1079618706 11:22527547-22527569 CAGACTAACAGCAGATCTCTCGG - Intergenic
1079681388 11:23302525-23302547 CAGACTAACAGCAGATCTCTCGG - Intergenic
1079842962 11:25426779-25426801 CAGACTAACAGCAGATCTCTCGG + Intergenic
1080346688 11:31333737-31333759 CAGACTAACAGCAGATCTCTTGG - Intronic
1081148939 11:39602766-39602788 CAGACTAACAGCAAATCTCTTGG - Intergenic
1081185625 11:40038935-40038957 CAGACTAACAGCAGATCTCTTGG + Intergenic
1081313349 11:41600670-41600692 CAGACTAACAGCAGATCTCTCGG + Intergenic
1081427609 11:42941974-42941996 CAGACTAACACCGGATCTCTCGG + Intergenic
1081433624 11:43003728-43003750 CAGACTAACAGCAGATCTCTCGG - Intergenic
1081682229 11:45016153-45016175 CAGACTAACAGCAGATTTCTCGG - Intergenic
1081946212 11:46996913-46996935 CAGACTAACAGCAGATCTCTTGG - Intronic
1082118004 11:48347762-48347784 CAGACTAACAGCAGATCTCTTGG + Intergenic
1082155287 11:48802793-48802815 CAGACTAACAGCAGATCTCTTGG - Intergenic
1082314138 11:50696213-50696235 CAGACTAACAGCAGATCTCTTGG + Intergenic
1082643009 11:55687287-55687309 CAGACTAACAGCAGATCTCTCGG + Intergenic
1082744160 11:56944501-56944523 CAGACTAACAGCAGATCTCTTGG - Intergenic
1082876931 11:57998519-57998541 CAGACTAACAGCAGATCTCTCGG - Intergenic
1082905900 11:58308491-58308513 CAGACTAACAGCTGATATCTCGG - Intergenic
1083494621 11:63040646-63040668 CAGACTAACAGCAGATCTCTCGG - Intergenic
1083498134 11:63077312-63077334 CAGACTAACAGCAGATCTCTCGG - Intergenic
1083501568 11:63113921-63113943 CAGACTAACAGCAGATCTCTCGG - Intronic
1083522876 11:63332436-63332458 CAGACTAACAGCAGATCTCTCGG - Intronic
1083524390 11:63348769-63348791 CAGACTAACAGCAGATCTCTCGG - Intronic
1084796944 11:71512807-71512829 CAGACTAACAGCAGATCTCTCGG + Intronic
1085797356 11:79554299-79554321 CAGACTAACAGCAGATCTCTCGG + Intergenic
1085800878 11:79587871-79587893 CAGACTAACAGCACATCTCTTGG + Intergenic
1085944511 11:81251530-81251552 CTGAATATCACATAATATCTTGG - Intergenic
1086149179 11:83589273-83589295 CAGACTAACAGCAGATCTCTCGG + Intronic
1086442232 11:86839734-86839756 CAGACTAACAGCAGATCTCTTGG + Intronic
1086516764 11:87622512-87622534 CAGACTAACAGCAGATCTCTCGG - Intergenic
1086785960 11:90970634-90970656 CAGACTAACAGCAGATCTCTCGG - Intergenic
1086869212 11:92016823-92016845 CAGATTAACAGCAGATTTCTTGG - Intergenic
1086918910 11:92563670-92563692 CAGACTAACAGCAGATCTCTCGG + Intronic
1086923662 11:92616834-92616856 CAGACTAACAGCAGATCTCTCGG - Intronic
1087067264 11:94038503-94038525 CAGACTAACAGCAGATCTCTCGG + Intronic
1087243584 11:95808002-95808024 CAGACTAACAGCAGATCTCTCGG + Intronic
1087305933 11:96488738-96488760 CAGACTAACAGCAGATCTCTCGG + Intronic
1087451432 11:98329259-98329281 CAGAATAACAGCAGATTTCTCGG - Intergenic
1087476381 11:98640711-98640733 CAAAATAACATGAAATATCAGGG - Intergenic
1087631370 11:100654141-100654163 CAGATTAACAGCAGATCTCTCGG + Intergenic
1087712414 11:101568647-101568669 CAGACTAACAGCGAATCTCTTGG + Intronic
1087824122 11:102745798-102745820 CAGACTAACAGCAGATCTCTCGG - Intergenic
1087887960 11:103502281-103502303 CAGAGTAACAGCAGATCTCTTGG + Intergenic
1087994979 11:104794376-104794398 TTTAATAACACCAAATATTTTGG + Intergenic
1088012317 11:105017939-105017961 CAGACTAACAGCAGATCTCTCGG + Intronic
1088151978 11:106756705-106756727 CAGACTAACAGCAGATCTCTCGG - Intronic
1088204300 11:107374403-107374425 CAGACTAACAGCAGATCTCTCGG + Intronic
1088301089 11:108358578-108358600 CAGACTAACAGCAGATCTCTCGG + Intronic
1088957796 11:114627302-114627324 CAGACTAACAGCAGATCTCTTGG + Intergenic
1088958652 11:114637822-114637844 CAGACTAACAGCAGATCTCTTGG - Intergenic
1090308736 11:125715862-125715884 CAGACTAACAGCAGATCTCTCGG - Intergenic
1090322458 11:125859121-125859143 CAGACTAACAGCAGATCTCTCGG + Intergenic
1090547395 11:127781056-127781078 CAGACTAACAGCAGATCTCTCGG - Intergenic
1090690484 11:129175575-129175597 CAGACTAACAGCAGATCTCTCGG + Intronic
1090706564 11:129343272-129343294 CAGACTAACAGCAGATCTCTCGG - Intergenic
1090816678 11:130303264-130303286 CAGCATAACTACAAACATCTTGG - Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1091925328 12:4342519-4342541 CAGACTAACAGCAGATCTCTTGG + Intronic
1091943347 12:4510528-4510550 CAGACTAACAGCAGATCTCTCGG + Intronic
1092011861 12:5120774-5120796 CAGACTAACAGCAGATCTCTCGG - Intergenic
1092313692 12:7387235-7387257 AAGAATAAAATAAAATATCTAGG + Intronic
1092397540 12:8141583-8141605 CAGAATAACAGCAATTTTCAGGG + Intronic
1092638412 12:10477327-10477349 CAGACTAACAGCAGATCTCTCGG - Intergenic
1092895588 12:13007227-13007249 AAGAAAGACACCAAATAGCTGGG - Intergenic
1093085763 12:14865693-14865715 CAGACTAACAGCGGATATCTCGG - Intronic
1093344639 12:18025547-18025569 CAGAATAACAGCTGATTTCTAGG + Intergenic
1093404428 12:18786988-18787010 CAGACTAACAGCAGATCTCTTGG + Intergenic
1093571391 12:20669482-20669504 CAGACTAACAGCAGATCTCTCGG + Intronic
1093970712 12:25373515-25373537 CAGAACAACACCTTAGATCTTGG + Intergenic
1093998134 12:25664801-25664823 CAGACTAACAGCAGATCTCTTGG - Intergenic
1094381734 12:29850224-29850246 CAGACTAACAGCAGATCTCTCGG + Intergenic
1094451817 12:30590130-30590152 CAGACTAACAGCAGATCTCTCGG + Intergenic
1094482165 12:30893391-30893413 CAGACTAACAGCACATCTCTTGG - Intergenic
1094561081 12:31554422-31554444 CAGACTAACAGCAGATCTCTTGG - Intronic
1094758040 12:33494356-33494378 CAGACTAACAGCAGATCTCTTGG + Intergenic
1094760130 12:33522516-33522538 CAGACTAACAGCAGATCTCTTGG + Intergenic
1095065207 12:37763476-37763498 CAGACTAACAGCAGATCTCTTGG + Intergenic
1095661623 12:44743084-44743106 CAGACTAACAGCAGATCTCTCGG + Intronic
1095720379 12:45393628-45393650 CAGACTAACAGCACATCTCTTGG + Intronic
1095830792 12:46584672-46584694 CAGACTAACAGCAGATCTCTTGG - Intergenic
1096044729 12:48552558-48552580 CAGACTAACAGCAGATCTCTTGG - Intergenic
1096902807 12:54902166-54902188 CAGACTAACAGCAGATCTCTCGG + Intergenic
1096962290 12:55591576-55591598 CAGACTAACAGCAGATCTCTTGG + Intergenic
1097301214 12:58021486-58021508 CAGACTAACAGCAGATCTCTTGG - Intergenic
1097310460 12:58113642-58113664 CAGAATAACAGCGGATCTCTCGG - Intergenic
1097467697 12:59948424-59948446 CAGACTAACAGCAGATCTCTCGG + Intergenic
1097568052 12:61295539-61295561 CAGACTAACAGCAGATCTCTCGG + Intergenic
1097734437 12:63166608-63166630 CAGACTAACAGCAGATCTCTCGG - Intergenic
1097917315 12:65034812-65034834 CAGACTAACAGCAGATCTCTCGG - Intergenic
1098175938 12:67791671-67791693 CAGACTAACAGCAGATCTCTCGG - Intergenic
1098398899 12:70052158-70052180 CAGACTAACAGCTAATCTCTCGG + Intergenic
1098615597 12:72519004-72519026 CAGACTAACAGCAGATCTCTCGG - Intronic
1098704783 12:73673169-73673191 CAGACTAACAGCAGATCTCTCGG + Intergenic
1098747262 12:74254240-74254262 CAGAATAACAGCAATTTTCAGGG - Intergenic
1098923180 12:76321270-76321292 CAGACTAACAGCAGATCTCTCGG + Intergenic
1098993728 12:77094805-77094827 CAGACTAACAGCAGATCTCTCGG - Intergenic
1099216820 12:79863100-79863122 CAGACTAACAGCAGATCTCTTGG + Intronic
1099225118 12:79960249-79960271 CAGAATAAGATCTAAAATCTGGG - Intergenic
1099268550 12:80479159-80479181 CAGACTAACAGCAGATCTCTCGG + Intronic
1099438663 12:82673529-82673551 CAGATTTACACAAAATACCTAGG + Intergenic
1099692222 12:85971266-85971288 CAGCGTACCACCAAATAACTGGG - Exonic
1099880841 12:88465587-88465609 CAGACTAACAGCGGATATCTCGG - Intergenic
1099901146 12:88713213-88713235 CAGACTAACAGCAGATCTCTCGG - Intergenic
1099912347 12:88848636-88848658 CAGACTAACAGCAGATCTCTCGG + Intergenic
1100753226 12:97722270-97722292 CAGACTAACAGCAGATCTCTGGG + Intergenic
1100814190 12:98369797-98369819 CAGAATAACACCCAATTTTCAGG + Intergenic
1101000218 12:100350180-100350202 ATGAATGACACCTAATATCTAGG + Intergenic
1101077699 12:101147683-101147705 CAGACTAACAGCAGATCTCTCGG + Intergenic
1101175080 12:102141844-102141866 CAGACTAACAGCAGATCTCTCGG - Intronic
1101301550 12:103488309-103488331 CAGACTAACAGCAGATATCTCGG - Intronic
1101500049 12:105295332-105295354 AATAATAACACTCAATATCTTGG + Intronic
1101636772 12:106550265-106550287 CAGACTAACAGCAGATCTCTTGG - Intronic
1101929210 12:108998594-108998616 CAGACTAACAGCAGATCTCTCGG + Intronic
1102007700 12:109598926-109598948 CAGATTAACTCAGAATATCTGGG - Intergenic
1102400313 12:112622841-112622863 CAGACTAACAGCAGATCTCTCGG + Intronic
1102440189 12:112957694-112957716 CAGACTAACAGCAGATCTCTCGG - Intronic
1104345803 12:127996471-127996493 CATAACAAAAACAAATATCTAGG + Intergenic
1104490208 12:129187388-129187410 CAGAATAACAGCCAAGAACTTGG + Intronic
1105338666 13:19498431-19498453 CAGACTAACAGCAGATCTCTCGG + Intronic
1105789249 13:23781237-23781259 CAGACTAACAGCAAATCTCTTGG + Intronic
1106040566 13:26086721-26086743 CAAAATAAAAACAAATTTCTGGG - Intergenic
1106745523 13:32701649-32701671 AAGAATAACAACAAATATACAGG - Intronic
1106817046 13:33419740-33419762 CAGACTAACAGCAGATCTCTTGG + Intergenic
1106913103 13:34484626-34484648 CAGACTAACAGCAGATCTCTCGG - Intergenic
1106914197 13:34494736-34494758 CAGACTAACAGCAGATCTCTTGG + Intergenic
1106959978 13:34987352-34987374 CAGACTAACAGCAGATCTCTCGG - Intronic
1107038600 13:35925877-35925899 CAGAATTACACTGCATATCTTGG - Intronic
1107090332 13:36472653-36472675 CAGACTAACAGCTGATATCTCGG - Intergenic
1107157106 13:37181204-37181226 CAAATTAACACAAAATCTCTGGG + Intergenic
1107231362 13:38113781-38113803 CAGACTAACAGCAGATCTCTCGG + Intergenic
1107486324 13:40830463-40830485 CAGACTAACAGCAGATCTCTCGG + Intergenic
1107971486 13:45646681-45646703 CAGACTAACAGCAGATCTCTCGG + Intergenic
1108308397 13:49161965-49161987 CAGACTAACAGCAGATCTCTCGG - Intronic
1108587767 13:51885600-51885622 CAGCATAACAGCAAATAAATGGG + Intergenic
1108673846 13:52719684-52719706 CAGACTAACAGCAGATCTCTTGG - Intronic
1108834654 13:54527790-54527812 CAGTACAACTCCAAATATCAAGG + Intergenic
1108916851 13:55624358-55624380 CAGAATAACAGCAATTTTCAGGG - Intergenic
1108988944 13:56630480-56630502 CAGACTAACACCGGATCTCTCGG + Intergenic
1109137869 13:58676981-58677003 CAGACTAACAGCAGATATCTCGG - Intergenic
1109312468 13:60711394-60711416 CAGACTAACAGCAGATCTCTCGG + Intergenic
1109385754 13:61627633-61627655 CAGACTAACAGCAGATCTCTCGG - Intergenic
1109457272 13:62609849-62609871 CAGACTAACAGCAGATCTCTCGG - Intergenic
1109586085 13:64406662-64406684 CAAAATAACAGCAAATATTAGGG + Intergenic
1109816386 13:67590142-67590164 CAGACTAACAGCAGATCTCTTGG + Intergenic
1110080159 13:71299268-71299290 CAGAATAACAGCAATTTTCAGGG - Intergenic
1110202802 13:72872846-72872868 CAGAAAAACATCAAATACTTAGG + Intronic
1110525358 13:76530580-76530602 AAGAAAAACACCAAATACTTAGG + Intergenic
1110606777 13:77442193-77442215 CAGACTAACAGCAGATCTCTCGG - Intergenic
1110652677 13:77960320-77960342 CAGACTAACAGCAGATGTCTCGG + Intergenic
1110818709 13:79888837-79888859 CAGACTAACAGCAGATCTCTTGG + Intergenic
1110998859 13:82151127-82151149 CAGAAAAAAATCAAATACCTAGG + Intergenic
1111374992 13:87367092-87367114 CAGACTAACAGCAGATCTCTCGG - Intergenic
1111680622 13:91437545-91437567 CAGACTAACAGCTGATATCTCGG - Intronic
1111765173 13:92518410-92518432 CAGACTAACAGCAGATCTCTCGG + Intronic
1111786370 13:92792193-92792215 CAGACTAACAGCAGATCTCTCGG + Intronic
1112980984 13:105383973-105383995 CAGACTAACAGCAGATCTCTCGG + Intergenic
1114151182 14:20041506-20041528 CAGACTAACAGCAGATCTCTCGG - Intergenic
1114167441 14:20234637-20234659 CAGACTAACAGCAGATCTCTCGG - Intergenic
1114749327 14:25185183-25185205 CAGACTAACAGCTGATATCTCGG + Intergenic
1114828382 14:26108046-26108068 CAGACTAACAGCAGATATCTCGG + Intergenic
1115412360 14:33089781-33089803 CAGACTAACAGCAGATCTCTCGG + Intronic
1115818613 14:37189565-37189587 CAGACTAACAGCAGATCTCTCGG + Intergenic
1115842552 14:37488796-37488818 CAGACTAACAGCAGATCTCTCGG - Intronic
1115942471 14:38624642-38624664 CACAAAAACACAAAATACCTAGG + Intergenic
1116026875 14:39525916-39525938 CAGACTAACAGCAGATCTCTCGG - Intergenic
1116038521 14:39657649-39657671 CAGACTAACAGCGAATCTCTCGG + Intergenic
1116042417 14:39701943-39701965 CAGACTAACAGCGAATCTCTCGG - Intergenic
1116092577 14:40327851-40327873 CAGACTAACAGCAGATCTCTCGG + Intergenic
1116094451 14:40349705-40349727 CAGACTAACAGCAGATCTCTCGG + Intergenic
1116120786 14:40719801-40719823 CAGACTAACAGCAGATCTCTCGG - Intergenic
1116156568 14:41213694-41213716 CAGACTAACAGCAGATCTCTCGG - Intergenic
1116162232 14:41282966-41282988 GATAATCACACAAAATATCTCGG - Intergenic
1116306537 14:43263709-43263731 CAGACTAACAGCAGATCTCTTGG + Intergenic
1116368710 14:44102823-44102845 AAGAATAAAAGCAAATATATGGG + Intergenic
1116407217 14:44580391-44580413 CAGACTAACAGCAGATCTCTCGG + Intergenic
1117260844 14:54032036-54032058 CAGACTAACAGCAGATCTCTCGG - Intergenic
1117489343 14:56230383-56230405 CAGACTAACAGCAGATCTCTCGG + Intronic
1117529102 14:56641298-56641320 CAGACTAACAGCAGATCTCTTGG + Intronic
1117635795 14:57741856-57741878 CAGACTAACAGCAGATCTCTTGG + Intronic
1117642520 14:57815168-57815190 TAGAATAACACCAAAAGTCACGG + Intronic
1117849278 14:59950856-59950878 CAGACTAACAGCAGATCTCTCGG - Intronic
1117872564 14:60216635-60216657 CAGAATAACTACTAATATTTTGG + Intergenic
1118146487 14:63143342-63143364 CAGACTAACAGCAGATCTCTGGG - Intergenic
1118465857 14:66030811-66030833 CAGACTAACAGCAGATCTCTGGG - Intergenic
1118515904 14:66528822-66528844 CAGACTAACAGCAGATCTCTCGG - Intronic
1118649007 14:67869719-67869741 CAGACTAACAGCAGATCTCTTGG + Intronic
1119467101 14:74866827-74866849 CAGAATAACAGCATATTTGTAGG + Intronic
1119853388 14:77882106-77882128 CACAATAACTCCAGCTATCTAGG - Intronic
1120064912 14:80029329-80029351 CAGACTAACAGCAGATCTCTCGG + Intergenic
1120069848 14:80090299-80090321 CAGACTAACAGCAGATCTCTCGG + Intergenic
1120555010 14:85919005-85919027 CAGAAAAATAACAAATATCTTGG + Intergenic
1120619740 14:86749343-86749365 CAGAATAACAGCAGATCTCTTGG - Intergenic
1120903004 14:89591847-89591869 CAGTATAACCCCAAATTCCTGGG - Intronic
1120971380 14:90211138-90211160 CAGACTAACAGCAGATCTCTCGG - Intergenic
1121177635 14:91903020-91903042 CAGCATCACACAAAATACCTAGG + Intronic
1121470556 14:94151015-94151037 CAGACTAACAGCAGATCTCTTGG - Intronic
1121633151 14:95435992-95436014 AAGAGAAACACAAAATATCTAGG + Intronic
1124896699 15:33784185-33784207 CAGAATAATCCCAGCTATCTTGG - Intronic
1125232081 15:37467938-37467960 CAGACTAACAGCAGATCTCTTGG - Intergenic
1125837542 15:42765902-42765924 CAGACTAACAGCAGATCTCTTGG + Intronic
1126021701 15:44408635-44408657 CAGGATAAGAGCAAATGTCTAGG - Intronic
1126071380 15:44867553-44867575 CAGACTAACAGCAGATCTCTCGG + Intergenic
1126074343 15:44894877-44894899 CAGACTAACAGCAGATCTCTTGG - Intergenic
1126083859 15:44991892-44991914 CAGACTAACAGCAGATCTCTCGG + Intergenic
1126178078 15:45757174-45757196 CAGACTAACAGCAGATCTCTCGG - Intergenic
1126720261 15:51570576-51570598 CAGACTAACAGCAGATCTCTTGG + Intronic
1126862911 15:52904175-52904197 CAGACTAACAGCAGATCTCTTGG + Intergenic
1127037070 15:54930432-54930454 CAGACTAACAGCAGATCTCTCGG - Intergenic
1127491597 15:59470066-59470088 CAGACTAACAGCAGATCTCTCGG - Intronic
1127934259 15:63621352-63621374 CAGACTAACAGCAGATATCTCGG - Intronic
1127971026 15:63961700-63961722 CAGACTAACAGCAGATCTCTCGG - Intronic
1129132436 15:73512803-73512825 CAGACTAACAGCAGATCTCTCGG - Intronic
1129796350 15:78380311-78380333 CAGACTAACAGCAGATATCTTGG - Intergenic
1129822049 15:78609361-78609383 CAGACTAACAGCAGATCTCTCGG + Intronic
1129967405 15:79749450-79749472 CAGACTAACAGCAGATCTCTTGG - Intergenic
1130382796 15:83385295-83385317 CAGACTAACAGCAGATCTCTCGG + Intergenic
1130737344 15:86564489-86564511 CAGACTAACAGCAGATCTCTCGG - Intronic
1131800260 15:96061083-96061105 CCAAATAACACCAAATATTGGGG - Intergenic
1131930404 15:97434474-97434496 CAGACTAACAGCAGATCTCTCGG + Intergenic
1132260376 15:100418714-100418736 CAGACTAACAGCAGATCTCTCGG + Intronic
1132287780 15:100677922-100677944 CAGACTAACAACAGATATCTTGG - Intergenic
1134774945 16:16844900-16844922 CAGACTAACAGCAGATCTCTCGG - Intergenic
1135854523 16:25994947-25994969 CTGAATAAAACCAAATCCCTGGG + Intronic
1136908742 16:34128491-34128513 CAGACTAACAGCAGATCTCTCGG - Intergenic
1136992391 16:35161797-35161819 CAGACTAACAGCAGATCTCTTGG + Intergenic
1137025564 16:35470318-35470340 CAGACTAACAGCAGATCTCTCGG + Intergenic
1137051747 16:35720183-35720205 CAGACTAACAGCTGATATCTTGG - Intergenic
1137304443 16:47184411-47184433 CAGACTAACAGCAGATCTCTCGG + Intronic
1137356320 16:47768694-47768716 CAGACTAACAGCAGATCTCTTGG + Intergenic
1137356715 16:47773548-47773570 CAGACTAACAGCAGATCTCTTGG - Intergenic
1137371632 16:47911637-47911659 CAGACTAACAGCAGATCTCTTGG + Intergenic
1137383365 16:48019825-48019847 CAGACTAACAGCGAATCTCTCGG - Intergenic
1137945231 16:52727474-52727496 CATAATAACAGTAAATTTCTAGG + Intergenic
1138712114 16:58981865-58981887 CAGAATAACAGCTGATCTCTCGG - Intergenic
1138720539 16:59074020-59074042 CAGAATAACAGCTGATCTCTCGG + Intergenic
1138722505 16:59098181-59098203 CAGAATAACAGCTGATCTCTCGG + Intergenic
1138843462 16:60537628-60537650 CAGACTAACAGCAGATCTCTCGG - Intergenic
1139050760 16:63121599-63121621 CAGACTAACAGCAGATCTCTCGG + Intergenic
1139214083 16:65110419-65110441 CAGAAAAACCCCAGATACCTAGG + Intronic
1140027910 16:71308113-71308135 CAGACTAACAGCAGATCTCTTGG + Intergenic
1140147585 16:72326166-72326188 CAGAGTAACAGCAGATCTCTTGG + Intergenic
1140803605 16:78511582-78511604 GAGAATAACAAGAAATATATTGG - Intronic
1141285772 16:82670201-82670223 CAGCATGACATCAAATATTTCGG - Intronic
1142532626 17:592745-592767 CAGACTAACAGCAGATCTCTCGG - Intronic
1142832286 17:2558144-2558166 CAGAAAAACTCCAAATAACAGGG - Intergenic
1142917211 17:3151734-3151756 CAGAATAACAGCAGATCTCTCGG - Intergenic
1142937596 17:3348814-3348836 CAGATTAACAGCAGATCTCTCGG + Intergenic
1144151648 17:12454266-12454288 CAGACTAACAGCAGATCTCTCGG - Intergenic
1144304878 17:13960235-13960257 TAGAATTACACCAATTACCTTGG - Intergenic
1144806342 17:17970835-17970857 CATAAGAACACCAAAGATCCTGG + Intronic
1144943528 17:18958066-18958088 GAAAAAAACAACAAATATCTTGG - Intronic
1145731129 17:27187285-27187307 CAGACTAACAGCAGATCTCTCGG - Intergenic
1146600785 17:34214100-34214122 CAGACTAACAGCAGATCTCTTGG - Intergenic
1146609992 17:34296807-34296829 CAGACTAACAGCAGATCTCTCGG - Intergenic
1147524170 17:41205233-41205255 CAGACTAACAGCAGATCTCTCGG - Intronic
1147527690 17:41241667-41241689 CAGACTAACAGCAGATCTCTCGG + Intronic
1148953034 17:51331303-51331325 CAGACTAACAGCAGATCTCTTGG - Intergenic
1149093673 17:52815768-52815790 CAGACTAACAGCAGATCTCTTGG - Intergenic
1149128051 17:53259321-53259343 CAGAATAACAACAGACATGTAGG + Intergenic
1149942505 17:60885803-60885825 CAGACTAACAGCAGATCTCTCGG - Intronic
1150026018 17:61674814-61674836 CAGACTAACAGCAGATCTCTCGG + Intergenic
1150897320 17:69227875-69227897 CAGATTAAAACCAAAAATATTGG + Intronic
1150972979 17:70051153-70051175 CACATTATCACCAAATATTTGGG - Intergenic
1153074259 18:1144539-1144561 CAGAATAACAGCAATTTTCAGGG - Intergenic
1153237606 18:3003777-3003799 CAGAATAACAGCAATTTTCAGGG + Intronic
1153420007 18:4894352-4894374 CAGACTAACAGCGAATCTCTCGG + Intergenic
1153634269 18:7099592-7099614 CAGAAGAAAACCTAAGATCTTGG + Intronic
1153727160 18:7968089-7968111 CAGACTAACAGCAGATCTCTCGG + Intronic
1154238076 18:12624866-12624888 CAGAATAACTCAAATTATCTGGG - Intronic
1155321439 18:24623406-24623428 CAGACTAACAGCAGATCTCTCGG - Intergenic
1155350719 18:24902896-24902918 CAGACTAACAGCAGATCTCTTGG + Intergenic
1155476719 18:26242942-26242964 CAGACTAACAGCAGATATCTTGG - Intronic
1155625018 18:27824726-27824748 CAGCATCACACCATATATCCAGG + Intergenic
1155675134 18:28420900-28420922 CAGACTAACAGCAGATCTCTCGG - Intergenic
1155765130 18:29620475-29620497 CAGGATAATGCTAAATATCTAGG + Intergenic
1156183770 18:34637830-34637852 CAGAATAAGGCCAATTAGCTGGG + Intronic
1156532425 18:37831121-37831143 CAGACTAACAGCGGATATCTCGG - Intergenic
1156678383 18:39559195-39559217 CAGGATAGCCACAAATATCTGGG + Intergenic
1156730830 18:40192003-40192025 CAGACTAACAGCAGATCTCTCGG - Intergenic
1156799086 18:41086912-41086934 CAGAATAACAGCAGATCTCTTGG + Intergenic
1156993533 18:43439312-43439334 CAGAATAACAGCAATTTTCAGGG + Intergenic
1157039590 18:44023162-44023184 CAGACTAACAGCAGATCTCTCGG - Intergenic
1157164388 18:45344870-45344892 CAGTTTAATTCCAAATATCTGGG - Intronic
1157164980 18:45350506-45350528 CAGTTTAATTCCAAATATCTGGG + Intronic
1157561630 18:48650757-48650779 CAGACTAACAGCAGATCTCTTGG + Intronic
1157758666 18:50242161-50242183 CAGAATAACAGCAATTTTCAGGG - Intronic
1158052941 18:53245563-53245585 CAGAAAAACATCAGATATGTCGG + Intronic
1158097799 18:53794126-53794148 CAGATTAACAGCAGATTTCTTGG + Intergenic
1158241300 18:55381127-55381149 AAGAATAGCACGAAATGTCTTGG + Intronic
1158647306 18:59258413-59258435 CAGAATAACAGCTGATCTCTCGG + Intergenic
1159143633 18:64426045-64426067 CAGACTAACAGCAGATCTCTTGG + Intergenic
1159155288 18:64574313-64574335 CAGACTAACAGCAGATCTCTTGG + Intergenic
1159347683 18:67228029-67228051 CAGAATAACAGCAATTTTCAGGG + Intergenic
1159377018 18:67605275-67605297 CAGACTAACAGCAGATCTCTCGG + Intergenic
1159466374 18:68789188-68789210 CAGACTAACAGCAGATCTCTCGG - Intronic
1159592168 18:70347308-70347330 CAGACTAACAGCAGATCTCTCGG - Intronic
1160600089 18:80005930-80005952 AAGAATAAGAAAAAATATCTAGG + Intronic
1162640852 19:12009147-12009169 CAGACTAACAGCAGATCTCTCGG - Intergenic
1162689463 19:12417244-12417266 CAGAATAACAGCAATTTTCAAGG + Intronic
1163380410 19:16962825-16962847 CAGACTAACAGCAGATCTCTTGG + Intronic
1163858395 19:19725435-19725457 CAGACTAACAGCAAATCTCTCGG - Intronic
1163894712 19:20048374-20048396 CAGAATAAAATAAACTATCTAGG + Intergenic
1163940169 19:20484231-20484253 CAGACTAACAGCAGATCTCTTGG + Intergenic
1164025614 19:21348993-21349015 CAGAATAACAGCAATTTTCAGGG - Intergenic
1164341889 19:24410278-24410300 CAGACTAACAGCAGATCTCTCGG - Intergenic
1164568533 19:29350119-29350141 CAGACTAACAGCAGATCTCTTGG + Intergenic
1165257435 19:34588113-34588135 CAGAATTCCGCCAAATATTTAGG - Intergenic
1165270648 19:34704740-34704762 CAGACTAACAGCAGATCTCTCGG - Intergenic
1165288001 19:34859122-34859144 CAGACTAACAGCAGATCTCTTGG + Intergenic
1165955930 19:39502197-39502219 CAAAAAAAAAACAAATATCTGGG + Intronic
1166156367 19:40914449-40914471 CAGACTAACAGCAGATCTCTTGG + Intergenic
1166357727 19:42236964-42236986 CAGAATACAACCAACTCTCTCGG + Intronic
1168369987 19:55824046-55824068 CAGACTAACAGCAGATCTCTCGG + Intronic
925431504 2:3798729-3798751 CAGACTAACAGCAGATCTCTCGG - Intronic
925470892 2:4159459-4159481 CAGACTAACAGCAGATCTCTCGG + Intergenic
925660587 2:6198335-6198357 CAGAATAACAGCAATTTTCAGGG + Intergenic
925672998 2:6331855-6331877 CAGACTAACAACAGATCTCTCGG - Intergenic
925960235 2:9007057-9007079 CAGAATTATACTAAATTTCTTGG - Intergenic
926507723 2:13737620-13737642 CAGACTAACAGCAGATCTCTCGG - Intergenic
926648735 2:15318031-15318053 CAGACTAACAGCAGATCTCTTGG + Intronic
926809311 2:16742315-16742337 AAGAATGACACCAAAAAACTAGG + Intergenic
927117372 2:19918025-19918047 CAGACTAACAGCAGATCTCTCGG + Intronic
928379599 2:30806138-30806160 CTGAATACAACCAAATAACTAGG + Intronic
928463530 2:31498077-31498099 CAGAATAACAGCAGATCTCTTGG + Intergenic
928793169 2:34983343-34983365 TACAATAAAACAAAATATCTAGG - Intergenic
929958181 2:46476404-46476426 CAGACTAACAGCAGATCTCTTGG - Intronic
930150744 2:48057246-48057268 CAGACTAACAGCAGATCTCTTGG - Intergenic
930220521 2:48741474-48741496 CAGACTAACAGCAGATCTCTCGG + Intronic
930255261 2:49083128-49083150 CAGACTAACAGCAGATCTCTCGG + Intronic
930274984 2:49300256-49300278 CAGACTAACAGCGGATATCTCGG + Intergenic
930517094 2:52421481-52421503 CAGACTAACAGCAGATCTCTCGG + Intergenic
930860161 2:56063907-56063929 CAGACTAACAGCAGATCTCTAGG - Intergenic
930908746 2:56605187-56605209 CAGACTAACAGCAGATCTCTCGG - Intergenic
930915513 2:56682727-56682749 CAGACTAACAGCAGATCTCTCGG - Intergenic
930962153 2:57275206-57275228 CAGACTAACAGCAGATCTCTTGG - Intergenic
930976506 2:57468649-57468671 AAAAATAACAACACATATCTTGG + Intergenic
930996987 2:57731534-57731556 CAAAATAACACAAAGTATTTGGG + Intergenic
931475649 2:62585208-62585230 CAGATTAACAGCAGATCTCTTGG - Intergenic
932072270 2:68633231-68633253 CAGCATCACACAAAATACCTAGG - Intergenic
932287461 2:70548813-70548835 TAGAATAACACTAAAAATCTAGG - Intronic
932646597 2:73509617-73509639 CAGACTAACAGCAGATCTCTTGG - Intronic
932979960 2:76652354-76652376 CAGACTAACAGCAGATCTCTCGG - Intergenic
933169508 2:79110051-79110073 CAGACTAACAACGAATCTCTCGG - Intergenic
933410654 2:81920965-81920987 CAGACTAACAGCAGATCTCTCGG - Intergenic
933590457 2:84226515-84226537 CAGACTAACAGCAGATCTCTTGG + Intergenic
934318682 2:91950858-91950880 CAGACTAACAGCAGATCTCTTGG + Intergenic
934702535 2:96453669-96453691 CAGACCAACACCAAACTTCTAGG + Intergenic
934796514 2:97105002-97105024 CAGACTAACAGCAGATCTCTCGG + Intergenic
934999822 2:99002268-99002290 CAGACTAACAGCAGATCTCTTGG + Intronic
935273760 2:101458568-101458590 CAGACTAACAGCAGATCTCTCGG - Intronic
935421884 2:102878386-102878408 CAGACTAACAGCAGATCTCTTGG - Intergenic
935631073 2:105212700-105212722 CAGACTAACAGCAGATCTCTTGG - Intergenic
935822796 2:106910957-106910979 CAGACTAACAGCAGATATCTCGG + Intergenic
935885038 2:107608553-107608575 AAGAATAATACCAAATATTAGGG + Intergenic
936448141 2:112613345-112613367 CAGACTAACAGCAGATCTCTCGG - Intergenic
936873191 2:117157669-117157691 CAGACTAACAGCAGATCTCTCGG + Intergenic
936874209 2:117168497-117168519 CAGGATAACAGCAAATTTCAGGG - Intergenic
936932633 2:117805429-117805451 CAGACTAACAGCAGATCTCTTGG + Intergenic
936967446 2:118141350-118141372 CAGACTAACAGCAGATCTCTCGG - Intergenic
936995692 2:118411367-118411389 CAGACTAACAGCAGATCTCTAGG + Intergenic
937011544 2:118567201-118567223 CTGAATAATACCAAGCATCTGGG - Intergenic
937189822 2:120084483-120084505 CAGACTAACAGCAGATCTCTCGG - Intronic
937489455 2:122350648-122350670 CAGACTAACAGCAGATCTCTCGG - Intergenic
937525649 2:122766050-122766072 CAGAAAAAAATAAAATATCTAGG + Intergenic
937573740 2:123393768-123393790 CAGACTAACAGCAGATCTCTTGG + Intergenic
938032258 2:128005145-128005167 CAGAAGAAGACAAAATATATGGG + Intronic
938122892 2:128646127-128646149 CAGCATAACAACAAAAATCCAGG + Intergenic
938148770 2:128863348-128863370 CAGACTAACAGCGGATATCTCGG - Intergenic
938217638 2:129533667-129533689 CAGACTAACAACAGATCTCTTGG + Intergenic
938445601 2:131375059-131375081 CAGACTAACAGCAGATCTCTTGG + Intergenic
938915761 2:135937849-135937871 CAGACTAACAGCTGATATCTCGG - Intronic
938975231 2:136470480-136470502 CAGACTAACAGCAGATCTCTTGG + Intergenic
939051516 2:137313865-137313887 CAGACTAACAGCAGATCTCTCGG - Intronic
939533235 2:143391304-143391326 CAGAATAAAACCTAGTTTCTTGG + Intronic
939695476 2:145317982-145318004 CAGCATAACATCACATATCCTGG - Intergenic
939876508 2:147584818-147584840 CAGACTAACAGCAGATCTCTTGG - Intergenic
940414283 2:153402286-153402308 CAGACTAACAGCAGATCTCTCGG - Intergenic
940826684 2:158420370-158420392 CAGACTAACAGCAGATCTCTCGG + Intronic
940836175 2:158524265-158524287 CAGACTAACAGCAGATCTCTCGG + Intronic
940996001 2:160150240-160150262 CAGATTAACAACAGATCTCTCGG + Intronic
941054210 2:160768253-160768275 CAGACTAACAGCAGATCTCTCGG + Intergenic
941190028 2:162369890-162369912 CTGCATAACACCAAATAGTTTGG + Intronic
941425961 2:165346067-165346089 CAGACTAACAGCAGATCTCTCGG - Intronic
941505233 2:166335937-166335959 CAGAATAACAACAATTACATTGG + Intronic
941532551 2:166687571-166687593 CAGACTAACAGCAGATCTCTTGG + Intergenic
942270554 2:174270078-174270100 CAGACTAACAGCAGATCTCTCGG + Intergenic
942285123 2:174408817-174408839 CAGACTAACAGCAGATCTCTCGG - Intronic
942467334 2:176222612-176222634 CAGACTAACAGCAGATCTCTCGG - Intergenic
942819778 2:180098920-180098942 CAGCAAAATATCAAATATCTAGG - Intergenic
942859247 2:180589966-180589988 CAGACTAACAGCAGATCTCTCGG - Intergenic
942873754 2:180766885-180766907 CAGACTAACAGCAGATCTCTTGG + Intergenic
943020258 2:182564413-182564435 CAGACTAACAGCAGATCTCTCGG - Intergenic
943038296 2:182773190-182773212 CAGACTAACAGCAGATCTCTCGG - Intronic
943159910 2:184234315-184234337 CAGACTAACAGCAGATCTCTTGG - Intergenic
943359463 2:186900469-186900491 CAGACTAACAGCAGATCTCTTGG - Intergenic
943629216 2:190232281-190232303 TCAAAAAACACCAAATATCTAGG + Intronic
943918481 2:193670029-193670051 TAGAATAAAACAAAATAACTTGG + Intergenic
943918557 2:193671489-193671511 TAGAATAAAACAAAATAACTTGG - Intergenic
943921121 2:193709265-193709287 CAGACTAACAGCAGATCTCTTGG - Intergenic
943987420 2:194640560-194640582 CAGACTAACAACATATCTCTTGG + Intergenic
944043009 2:195377577-195377599 CAGACTAACAGCAGATCTCTCGG - Intergenic
944056260 2:195524769-195524791 CAGACTAACAGCAGATCTCTCGG + Intergenic
944077241 2:195745638-195745660 CAGACTAACAGCAGATCTCTGGG + Intronic
944630001 2:201614342-201614364 CAGACTAACAGCAGATCTCTTGG + Intronic
945150374 2:206784336-206784358 CAGAATAACTCAAAGTATTTGGG + Intronic
945151077 2:206792671-206792693 CAGAATAACACCAACTTGCATGG - Intergenic
945162772 2:206909673-206909695 CAGACTAACAGCAGATCTCTTGG + Intergenic
945351535 2:208786046-208786068 CAGACTAACAGCAGATCTCTCGG + Intronic
945352856 2:208802418-208802440 CAGACTAACAGCAGATCTCTTGG + Intronic
945361017 2:208895696-208895718 CAGACTAACAGCAGATCTCTTGG + Intergenic
945365582 2:208949076-208949098 CAGATACACACCAAATCTCTTGG + Intergenic
945715938 2:213358115-213358137 CAGACTAACAGCAGATCTCTCGG - Intronic
946650018 2:221883237-221883259 CAGAAAAACACCAAATTTCCTGG + Intergenic
946763000 2:223013639-223013661 CAGACTAACAGCAGATCTCTTGG + Intergenic
946786973 2:223257758-223257780 CAGACTAACAGCAAATGTCTCGG - Intergenic
946794234 2:223332277-223332299 CAGACTAACAGCAGATCTCTTGG + Intergenic
946799145 2:223391629-223391651 CAGAATATCACATTATATCTTGG + Intergenic
946923939 2:224607416-224607438 CAGAGGAACCCCAAATAGCTCGG - Intergenic
947259376 2:228203506-228203528 CAGACTAACAGCAGATCTCTCGG - Intergenic
947456904 2:230263828-230263850 CAGATTAACAGCAGATTTCTTGG - Intronic
1169173659 20:3488934-3488956 CAAACAAACATCAAATATCTTGG - Intronic
1169396862 20:5240098-5240120 CAGACTAACAGCAGATCTCTCGG - Intergenic
1169516255 20:6320179-6320201 CAGACTAACAGCAGATCTCTTGG - Intergenic
1170049607 20:12128059-12128081 CAGACTAACAGCAGATCTCTCGG - Intergenic
1170090449 20:12584153-12584175 CAGACTAACAGCAGATCTCTCGG + Intergenic
1170660547 20:18334703-18334725 CAGACTAACAGCAGATCTCTCGG + Intergenic
1170914016 20:20605137-20605159 CAGGTTAACACCAGATGTCTAGG - Intronic
1171094653 20:22319976-22319998 CAAAATACCATAAAATATCTGGG - Intergenic
1171153850 20:22853174-22853196 CAGACTAACAGCAGATCTCTTGG + Intergenic
1171177126 20:23060820-23060842 CAGAATTCCTCCAGATATCTGGG - Intergenic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1173232149 20:41206932-41206954 CAGAATAACAGCGGATCTCTCGG + Intronic
1173543693 20:43875486-43875508 CAGACTAACAGCAAATCTCTCGG - Intergenic
1173771627 20:45664775-45664797 CAGACTAACAGCAGATCTCTAGG - Intronic
1174187537 20:48717271-48717293 CAGAACAACACCAACTTTCTGGG + Intronic
1174939193 20:54905736-54905758 CAGAATAACAGCTGATCTCTCGG - Intergenic
1175512034 20:59536136-59536158 CAGACTAACAGCAGATCTCTCGG - Intergenic
1176322836 21:5350392-5350414 CAGACTAACAGCAGATCTCTTGG + Intergenic
1176480490 21:7282012-7282034 CAGACTAACAGCAGATCTCTTGG + Intergenic
1176759922 21:10771400-10771422 CAGACTAACAACAGATCTCTTGG + Intergenic
1176858936 21:13993818-13993840 CAGACTAACAGCAGATCTCTCGG - Intergenic
1176914603 21:14610076-14610098 CAGGATAACAGCAATTTTCTGGG + Intronic
1177273096 21:18874436-18874458 CAGACTAACAGCAGATATCTCGG - Intergenic
1177451192 21:21268828-21268850 CAAAATAGCACCAAGTATTTTGG + Intronic
1177458972 21:21384506-21384528 CAGGAAAATACCAAATATATTGG + Intronic
1177892443 21:26822860-26822882 CAGATGGAAACCAAATATCTTGG + Intergenic
1179962831 21:44779980-44780002 CAGAATAAGAAAAAATGTCTGGG + Intronic
1180124153 21:45777271-45777293 CAGACTGACAGCAAATTTCTGGG - Intronic
1180306862 22:11134530-11134552 CAGACTAACAGCAGATCTCTTGG + Intergenic
1180545382 22:16496713-16496735 CAGACTAACAGCAGATCTCTTGG + Intergenic
1182197202 22:28530692-28530714 CAGACTAACAGCAGATGTCTCGG + Intronic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
1182989111 22:34749980-34750002 CAGACTAACAGCTGATATCTTGG - Intergenic
1183003826 22:34883736-34883758 CACAGAAACACCAAATGTCTTGG + Intergenic
1183762967 22:39842095-39842117 CAGACTAACAGCAGATCTCTCGG - Intronic
1184983154 22:48109266-48109288 AACGATAACAACAAATATCTGGG + Intergenic
1203331221 22_KI270738v1_random:90785-90807 CAGACTAACAGCAGATCTCTCGG + Intergenic
949137091 3:580855-580877 CAGACTAACAGCAGATCTCTCGG - Intergenic
949201864 3:1389196-1389218 CAGACTAACAGCAGATCTCTCGG + Intronic
949231374 3:1754751-1754773 CAGAATAACAGCAATTTTCAGGG - Intergenic
949276568 3:2290104-2290126 CAAAATAACAACAAAAATGTGGG + Intronic
949377130 3:3403154-3403176 CAAAATAACCCCAAATAACCTGG + Intergenic
949427975 3:3940229-3940251 CAGACTAACAGCAGATCTCTGGG - Intronic
949450192 3:4176321-4176343 CAGACTAACAGCAGATCTCTTGG + Intronic
949666285 3:6342587-6342609 CAGACTAACAGCAGATCTCTCGG + Intergenic
949749476 3:7334236-7334258 CAGATTAACAGCAGATTTCTCGG + Intronic
949874106 3:8613148-8613170 CAGACTAACAGCAGATCTCTTGG + Intergenic
949888962 3:8717720-8717742 CAGACTAACAGCAGATCTCTTGG + Intronic
951071028 3:18329641-18329663 CAGACTAACAGCAGATCTCTTGG - Intronic
951101356 3:18692630-18692652 CAGACTAACAGCAGATCTCTCGG - Intergenic
951167441 3:19499571-19499593 CAGACTAACAGCAGATCTCTCGG + Intronic
951175525 3:19594621-19594643 CAGACTAACAGCAGATCTCTTGG - Intergenic
951198332 3:19849045-19849067 CAGATTAACAGCAGATTTCTCGG + Intergenic
951286446 3:20819760-20819782 CAGACTAACAGCAGATCTCTTGG - Intergenic
951368466 3:21813985-21814007 CAGACTAACAGCAGATCTCTCGG + Intronic
951439732 3:22708680-22708702 CAGACTAACAGCAGATCTCTCGG + Intergenic
951474554 3:23091666-23091688 CAGACTAACACCTGATCTCTCGG - Intergenic
951497952 3:23351019-23351041 CAGACTAACAGCAGATCTCTCGG + Intronic
951503471 3:23416409-23416431 CAGACTAACAGCAGATCTCTTGG - Intronic
951592478 3:24281220-24281242 CAGACTAACAGCAGATCTCTCGG + Intronic
951784429 3:26402381-26402403 CAGACTAACAGCAGATCTCTCGG - Intergenic
951791792 3:26494033-26494055 CAGACTAACAGCAGATCTCTCGG - Intergenic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
952472771 3:33673225-33673247 CAGACTAACAGCAGATGTCTCGG + Intronic
952493375 3:33893699-33893721 CAAAATAAAACAAAATACCTAGG - Intergenic
953105674 3:39876700-39876722 CAGACTAACAGCAGATCTCTCGG - Intronic
953218894 3:40949618-40949640 CAGACTAACAGCAGATCTCTTGG - Intergenic
953513526 3:43567466-43567488 CAGACTAACAGCAGATCTCTCGG + Intronic
953852783 3:46478753-46478775 CAGAATATTTCCAAATATCCTGG - Intronic
954488597 3:50878911-50878933 CAGACTAACAGCAGATCTCTCGG + Intronic
954572824 3:51656353-51656375 AAGAATAACAACACATAACTGGG + Intronic
955252065 3:57293681-57293703 AAGAATAACACCAAAACACTTGG + Intronic
955630140 3:60964789-60964811 CAGACTAACAACAGATCTCTTGG - Intronic
955652852 3:61212785-61212807 CAGACTAACAGCGGATATCTCGG + Intronic
956032627 3:65055499-65055521 CAGACTAACAGCAGATCTCTCGG + Intergenic
956317047 3:67949550-67949572 CAGACTAACAGCAGATCTCTCGG + Intergenic
956328606 3:68080672-68080694 CAGACTAACAGCAGATCTCTCGG - Intronic
956550156 3:70449376-70449398 CAGACTAACAGCAGATCTCTCGG - Intergenic
956800297 3:72751746-72751768 CAGAATAATATCAAATGTTTGGG - Intronic
957018372 3:75096344-75096366 CAGACTAACAGCAGATCTCTTGG - Intergenic
957344752 3:78946305-78946327 CAGACTAACAGCTAATCTCTTGG + Intronic
957735635 3:84198359-84198381 AAGACTAACAGCAAATTTCTTGG + Intergenic
958171280 3:89943448-89943470 CAGACTAACAGCAGATCTCTTGG - Intergenic
958205547 3:90386789-90386811 CAGACTAACAGCAGATCTCTCGG - Intergenic
958404107 3:93730387-93730409 CAGACTAACAGCAGATCTCTCGG - Intergenic
958407660 3:93768585-93768607 CAGACTAACAGCAGATCTCTCGG + Intergenic
958495408 3:94837807-94837829 CAGACTAACAGCAGATCTCTTGG + Intergenic
958769411 3:98408356-98408378 CAGACTAACAGCAGATCTCTTGG + Intergenic
958828687 3:99063025-99063047 CAGACTAACAGCAGATCTCTTGG - Intergenic
958957093 3:100476735-100476757 CAGACTAACAGCAGATTTCTTGG - Intergenic
958969775 3:100599351-100599373 CAGATTAACAGCAGATTTCTCGG - Intergenic
958978063 3:100689733-100689755 CAGACTAACAGCACATCTCTCGG - Intronic
959569084 3:107862893-107862915 CAGAAAAACTCCAGATATCGAGG - Intergenic
959654485 3:108785948-108785970 CAGAAAAACATAAAATATTTAGG - Intergenic
959694659 3:109235947-109235969 CAGACTAACAGCAGATCTCTTGG + Intergenic
959725799 3:109539961-109539983 CAGACTAACAGCAGATCTCTTGG + Intergenic
959744527 3:109760924-109760946 CAGACTAACAGCAGATCTCTTGG + Intergenic
959812521 3:110636382-110636404 CAGACTAACAGCAGATCTCTCGG - Intergenic
959833347 3:110890467-110890489 CAGACTAACAGCAGATCTCTCGG + Intronic
959835649 3:110915797-110915819 CAGACTAACAGCAGATCTCTCGG - Intergenic
960065560 3:113368373-113368395 CAGACTAACAGCAGATCTCTCGG + Intronic
960229197 3:115204830-115204852 GAAACTAACAGCAAATATCTTGG - Intergenic
960238804 3:115316677-115316699 CAGACTAACAGCAGATCTCTTGG - Intergenic
960565973 3:119131834-119131856 CAGACTAACAGCAGATCTCTTGG + Intronic
960646327 3:119888623-119888645 CAGAATAACAGCAATTTTCAGGG + Intronic
960656104 3:120005558-120005580 CAGACTAACAGCAGATCTCTCGG + Intronic
960753012 3:120977903-120977925 CAGACTAACAGCAGATCTCTTGG - Intronic
960787523 3:121390742-121390764 CAGACTAACAGCAGATCTCTTGG - Intronic
960832198 3:121862029-121862051 CAGACTAACAGCAGATCTCTCGG - Intronic
960961374 3:123072739-123072761 CAGAATAAAACCACAAAGCTGGG - Intronic
961303580 3:125938284-125938306 CAGACTAACAGCAGATCTCTTGG + Intergenic
961341076 3:126219675-126219697 CATAATAACAAAAAATATTTAGG + Intergenic
961355140 3:126333204-126333226 CAGACTAACAGCAGATCTCTCGG + Intergenic
962161318 3:133003868-133003890 CAGACTAACAGCAGATCTCTTGG - Intergenic
962178069 3:133175455-133175477 CAGACTAACAGCAGATCTCTTGG + Intronic
962291618 3:134141649-134141671 CAGACTAACAGCAGATCTCTTGG + Intronic
962394571 3:135004317-135004339 CAGACTAACAGCAGATCTCTCGG - Intronic
962424318 3:135256577-135256599 CAGACTAACAGCAGATCTCTCGG - Intronic
962497617 3:135957674-135957696 CAGAATAACAGCAATTTTCTGGG - Intergenic
962602636 3:137006123-137006145 CAGACTAACAGCAGATCTCTTGG - Intronic
962675344 3:137752480-137752502 CAGACTAACAGCAGATCTCTCGG + Intergenic
962767141 3:138575734-138575756 CAGACTAACAGCAGATCTCTTGG + Intronic
963048328 3:141121270-141121292 CAGACTAACAGCGAATCTCTTGG - Intronic
963423646 3:145094950-145094972 CAGAATAACATTAAAGAACTAGG - Intergenic
963514529 3:146292253-146292275 CAGACTAACAGCAGATCTCTCGG - Intergenic
963528054 3:146439133-146439155 CAGACTAACAGCAGATCTCTCGG - Intronic
965082368 3:164050858-164050880 CACAAAGACACCAAATATTTGGG - Intergenic
965091404 3:164167693-164167715 AAGCAAAACACCAGATATCTTGG + Intergenic
965100646 3:164293181-164293203 CAGACTAACAGCGGATATCTCGG + Intergenic
965131300 3:164704254-164704276 CAGACTAACAGCAGATCTCTCGG + Intergenic
965228751 3:166025459-166025481 CAGACTAACAGCAGATCTCTCGG - Intergenic
966905183 3:184518566-184518588 AAGAATAAAATCAAATATATCGG - Intronic
967265271 3:187685929-187685951 CAGAATAACAGCAATTTTCAGGG + Intergenic
967285431 3:187864127-187864149 CAGACTAACAGCAGATCTCTTGG + Intergenic
967339080 3:188377064-188377086 CAGACTAACAGCAGATCTCTCGG - Intronic
967397169 3:189021590-189021612 CAGACTAACAGCAGATCTCTCGG - Intronic
967737016 3:192963987-192964009 CAGACTAACAGCAGATCTCTCGG - Intergenic
967737636 3:192970224-192970246 CAGACTAACAGCAGATCTCTTGG - Intergenic
969127029 4:4958250-4958272 CAGACTAACAGCAGATCTCTCGG - Intergenic
969306788 4:6330398-6330420 CACAGAAACACCAAGTATCTGGG - Intronic
969879490 4:10161358-10161380 AAGAATAACAGCAAAGAGCTTGG + Intergenic
969972750 4:11065275-11065297 CAGACTAACAGCAGATCTCTCGG - Intergenic
969980291 4:11147983-11148005 CAGACTAACAGCAGATCTCTCGG - Intergenic
970040786 4:11794406-11794428 CAGACTAACAGCAGATCTCTCGG + Intergenic
970283410 4:14482397-14482419 CAGAATAACAGCGGATCTCTCGG + Intergenic
970489641 4:16558843-16558865 CAGACTAACAGCAGATCTCTCGG + Intronic
970775605 4:19670330-19670352 CAGACTAACAGCAGATCTCTAGG + Intergenic
970796522 4:19920019-19920041 CAGACTAACAGCAGATCTCTTGG - Intergenic
970896275 4:21107958-21107980 CAGACTAACAGCAGATTTCTCGG - Intronic
971050257 4:22854161-22854183 CAGATTAACAGCAGATTTCTCGG - Intergenic
971466990 4:26974596-26974618 CAGACTAACAGCGAATCTCTTGG - Intronic
971560966 4:28079065-28079087 CAGACTAACAGCAGATCTCTCGG + Intergenic
971621157 4:28855864-28855886 CAGACTAACAGCAGATCTCTTGG - Intergenic
971883430 4:32411123-32411145 CAGACTAACAGCAGATCTCTTGG + Intergenic
972317712 4:37943194-37943216 CAGACTAACAGCAGATCTCTCGG - Intronic
972965170 4:44500772-44500794 CAGACTAACAGCAGATCTCTTGG - Intergenic
973035914 4:45405904-45405926 CACAGACACACCAAATATCTGGG - Intergenic
973137585 4:46726975-46726997 CAGACTAACAGCGGATATCTCGG - Intergenic
973533226 4:51853694-51853716 CTGAAAAACACCAAATACCAGGG - Intronic
973630787 4:52818103-52818125 CAGACTAACAGCAGATCTCTCGG + Intergenic
973661115 4:53107009-53107031 CAGACTAACAGCAGATATCTTGG + Intronic
973670984 4:53218001-53218023 CAGAGTAACAGCAGATCTCTTGG - Intronic
973683150 4:53341740-53341762 CAGACTAACAGCAGATCTCTCGG + Intronic
973732402 4:53835129-53835151 CAGACTAACAGCAGATCTCTTGG + Intronic
973835935 4:54808869-54808891 CAGACTAACAGCAGATCTCTTGG + Intergenic
973871185 4:55168463-55168485 CAGACTAACAGCAGATCTCTCGG - Intergenic
974127688 4:57715881-57715903 CAGACTAACAGCAGATCTCTTGG + Intergenic
974141016 4:57886748-57886770 CAGACTAACAGCAGATCTCTTGG + Intergenic
974398542 4:61371589-61371611 CAGACTAACAGCAGATCTCTTGG - Intronic
974541955 4:63249336-63249358 CAGACTAACAGCAGATCTCTTGG - Intergenic
974591354 4:63952436-63952458 CAGACTAACAGCAGATATCTCGG - Intergenic
974820967 4:67066725-67066747 CAGACTAACAGCAGATCTCTTGG - Intergenic
974961176 4:68703155-68703177 CAGAATAACAGCAATTTTCAGGG + Intergenic
975149220 4:71003315-71003337 CAGACTAACAGCAGATCTCTCGG - Intronic
975203430 4:71617586-71617608 CAGACTAACAGCAGATCTCTTGG + Intergenic
975236047 4:71997833-71997855 CAGACTAACAGCAGATCTCTCGG + Intergenic
975348599 4:73321475-73321497 CAGACTAACAGCAGATCTCTCGG + Intergenic
975352571 4:73361889-73361911 CAGACTAACAGCAGATCTCTTGG + Intergenic
975367556 4:73546227-73546249 CAGACTAACAGCAGATCTCTTGG + Intergenic
975500383 4:75078587-75078609 CAGACTAACAGCAGATCTCTTGG - Intergenic
975503377 4:75111632-75111654 CAGACTAACAGCAGATCTCTCGG + Intergenic
975505131 4:75128453-75128475 CAGACTAACAGCAGATCTCTCGG + Intergenic
975535565 4:75446895-75446917 CAGACTAACAGCAGATCTCTCGG - Intergenic
975726755 4:77299841-77299863 CAGACTAACAGCAGATCTCTTGG - Intronic
975729686 4:77325972-77325994 CAGACTAACAGCCAATCTCTCGG - Intronic
975965571 4:79968552-79968574 CAGACTAACAGCAGATCTCTCGG + Intronic
976063365 4:81155712-81155734 CAGACTAACAGCAGATCTCTCGG + Intronic
976100536 4:81558189-81558211 AAGAATAACTTCTAATATCTAGG + Intronic
976197360 4:82545993-82546015 CAAAATAAAACAAAAAATCTAGG + Intronic
976342004 4:83956542-83956564 CAGACTAACAGCAGATGTCTCGG - Intergenic
976352327 4:84074140-84074162 CAGACTAACAGCAGATGTCTCGG + Intergenic
976363441 4:84206730-84206752 CAGAATAACAGCAATTTTCAGGG - Intergenic
976372051 4:84300425-84300447 CAGACTAACAGCAGATGTCTCGG + Intergenic
976490572 4:85665874-85665896 CAGACTAACAGCAGATCTCTTGG - Intronic
976506308 4:85851807-85851829 CAGACTAACAGCAGATCTCTCGG - Intronic
976592703 4:86864765-86864787 CAGACTAACAGCAGATCTCTTGG + Intergenic
976731966 4:88271741-88271763 CAGTATACCACCAAATTACTGGG + Intronic
976760235 4:88540728-88540750 CAGACTAACAGCAGATCTCTCGG + Intronic
976874818 4:89839825-89839847 CAGCATATCACCAAAACTCTTGG - Intergenic
976941187 4:90704332-90704354 CAGACTAACAGCTGATATCTCGG - Intronic
977110135 4:92942928-92942950 CAGAATAACAGCAGATCTCTCGG - Intronic
977455896 4:97259167-97259189 CAGATTAACAGCAGATCTCTCGG - Intronic
977774607 4:100902214-100902236 CAGACTAACAGCAGATCTCTTGG + Intergenic
977843821 4:101743252-101743274 CAGACTAACAGCAGATCTCTCGG - Intronic
977906149 4:102479677-102479699 CAGACTAACAGCAGATATCTTGG + Intergenic
978055095 4:104253726-104253748 CAGACTAACAGCAGATCTCTTGG + Intergenic
978139261 4:105298835-105298857 CAGACTAACAGCAGATCTCTTGG + Intergenic
978150470 4:105427982-105428004 CAGACTAACAGCAGATCTCTTGG + Intronic
978363746 4:107958446-107958468 CAGAATAACAACGACTCTCTCGG + Intergenic
978412354 4:108439777-108439799 CAGACTAACAGCAGATCTCTTGG - Intergenic
978626536 4:110692021-110692043 CAGACTAACAGCAGATCTCTCGG - Intergenic
978632348 4:110761837-110761859 CAGACTAACAGCAGATCTCTTGG - Intergenic
978833724 4:113121191-113121213 GAGAATAATACCTAATATATAGG - Intronic
979085737 4:116407351-116407373 CAGACTAACAGCAGATCTCTTGG + Intergenic
979119861 4:116884016-116884038 CAGATTAACAGCAGATCTCTCGG + Intergenic
979462526 4:121000378-121000400 CAGACTAACAGCAGATCTCTCGG - Intergenic
979729985 4:124012751-124012773 CAGACTAACAGCAGATCTCTTGG - Intergenic
979750516 4:124273722-124273744 CAGACTAACAGCAGATCTCTTGG - Intergenic
979757779 4:124363019-124363041 CAGACTAACAGCAGATCTCTCGG + Intergenic
980180967 4:129399988-129400010 CAGAATAACAGCAATTTTCAGGG - Intergenic
980807407 4:137831190-137831212 CAGAATAACAGCAATTTTCAGGG - Intergenic
981188661 4:141835387-141835409 CAGACTAACAGCAGATCTCTCGG + Intergenic
981208952 4:142078404-142078426 CACAATACCACCAAATACATAGG + Intronic
981211770 4:142115444-142115466 CAGACTAACAGCAGATCTCTTGG + Intronic
981445992 4:144838510-144838532 CAGACTAACAGCAGATCTCTCGG + Intergenic
981560780 4:146046622-146046644 CAGACTAACAGCAAATCTCTCGG - Intergenic
981632482 4:146836306-146836328 CAGAAAAACAGGAAATATATAGG + Intronic
981684300 4:147435796-147435818 CAGACTAACAGCAGATCTCTCGG + Intergenic
981961110 4:150540088-150540110 AAGAATATCACAAAATACCTAGG + Intronic
982454780 4:155595980-155596002 TAGAATAACACAAGATCTCTAGG + Intergenic
982887401 4:160798614-160798636 CAGAATAACAGCAATTTTCAGGG - Intergenic
982937437 4:161499871-161499893 AAGAATAACACCGAATATCATGG + Intronic
983140503 4:164143455-164143477 CAGACTAACAGCAGATCTCTCGG + Intronic
983173837 4:164564875-164564897 CAGACTAACAGCAGATCTCTCGG + Intergenic
983183712 4:164677668-164677690 CAGACTAACAGCAGATCTCTCGG + Intergenic
983244260 4:165269671-165269693 CAGACTAACAGCAGATTTCTTGG - Intronic
983594475 4:169450462-169450484 CAGACTAACAGCAGATCTCTCGG + Intronic
983673691 4:170267661-170267683 CAGACTAACAGCTGATATCTAGG - Intergenic
983694259 4:170509444-170509466 CAGACTAACAGCAGATCTCTTGG - Intergenic
983828899 4:172300728-172300750 CAGACTAACAGCTGATATCTCGG - Intronic
983884992 4:172970617-172970639 CAGAATAACAGCAATTTTCAGGG - Intronic
984295435 4:177848265-177848287 CAGACTAACAGCAGATCTCTTGG - Intronic
984307768 4:178016679-178016701 CAGACTAACAGCAGATCTCTTGG + Intergenic
984380806 4:178989982-178990004 CAGACTAACAGCAGATCTCTTGG + Intergenic
984382033 4:179006801-179006823 CAGAATACCAATAATTATCTTGG + Intergenic
984406655 4:179341258-179341280 TTCAATAACACCAATTATCTGGG + Intergenic
984457469 4:179988361-179988383 CAGACTAACAGCAGATCTCTCGG + Intergenic
985307771 4:188562619-188562641 CAGACTAACAGCAGATCTCTCGG - Intergenic
985978373 5:3440680-3440702 CAGACTAACAGCAGATCTCTCGG + Intergenic
986126925 5:4891925-4891947 CAGACTAACAGCAAACCTCTTGG - Intergenic
986149447 5:5114022-5114044 CAGAATAATAGCAGATCTCTTGG - Intergenic
986322887 5:6648136-6648158 CAGACTAACAGCAGATCTCTTGG - Intronic
986379814 5:7172328-7172350 CAGACTAACAGCAGATCTCTCGG + Intergenic
986381973 5:7195415-7195437 CAGACTAACAGCAGATCTCTCGG + Intergenic
986530610 5:8732624-8732646 CAGACTAACAGCTGATATCTTGG + Intergenic
987172524 5:15273044-15273066 CAGACTAACAGCAGATCTCTTGG + Intergenic
987184148 5:15397896-15397918 CAGACTAACAGCAGATCTCTCGG + Intergenic
987279570 5:16399313-16399335 CAGACTAACAGCGAATCTCTTGG - Intergenic
987424068 5:17753961-17753983 CAGACTAACACCAGATCTCTTGG - Intergenic
987605979 5:20136947-20136969 CAGACTAACAGCAGATCTCTTGG - Intronic
987832055 5:23106931-23106953 CAGAATAACAGTGAATTTCTCGG + Intergenic
987899459 5:23992473-23992495 CAAAATAAGAGAAAATATCTCGG + Intronic
988023538 5:25654545-25654567 CAGACTAACAGCAGATCTCTCGG - Intergenic
988089898 5:26524497-26524519 CAAAATAAAATAAAATATCTAGG + Intergenic
988381127 5:30498185-30498207 CAGACTAACAGCAGATCTCTTGG - Intergenic
988671910 5:33390464-33390486 CAGACTAACAGCAGATCTCTCGG + Intergenic
988976432 5:36521178-36521200 CACAACAACAACAACTATCTGGG - Intergenic
989072355 5:37524263-37524285 CAGAATAACAGCTGATTTCTCGG + Intronic
989253806 5:39344805-39344827 CAGACTAACAGCAGATCTCTCGG + Intronic
989337698 5:40337670-40337692 CAGACTAACAGCAGATCTCTCGG + Intergenic
989449348 5:41568894-41568916 CAGACTAACAGCAGATCTCTCGG - Intergenic
989453016 5:41609088-41609110 CAGACTAACAGCAGATCTCTTGG - Intergenic
989540052 5:42607548-42607570 CAAAATAACAGCAAATAACAAGG + Intronic
989608053 5:43264977-43264999 CAGACTAACAGCAGATCTCTCGG - Intronic
989662227 5:43812532-43812554 CAGACTAACAGCACATCTCTCGG - Intergenic
989733036 5:44670148-44670170 CAGACTAACAGCAGATCTCTTGG + Intergenic
989768615 5:45116172-45116194 CAGACTAACAGCAGATCTCTTGG - Intergenic
989784796 5:45314146-45314168 CAGACTAACAGCGAATCTCTCGG + Intronic
989816805 5:45747425-45747447 CAGACTAACAGCAGATCTCTTGG - Intergenic
989946155 5:50231874-50231896 CAGACTAACAGCAGATCTCTTGG + Intergenic
990034842 5:51306265-51306287 CAGACTAACAGCAGATCTCTCGG + Intergenic
990684884 5:58289695-58289717 CAGACTAACAGCAGATCTCTCGG + Intergenic
990783782 5:59396365-59396387 CAGACTAACAGCAGATCTCTCGG + Intronic
990843101 5:60105645-60105667 CAGACTAACAGCAGATCTCTTGG + Intronic
990860211 5:60318843-60318865 CAGACTAACAGCAGATCTCTTGG - Intronic
990884260 5:60574319-60574341 CAGACTAACAGCAGATCTCTCGG - Intergenic
990913684 5:60880224-60880246 CAGACTAACAGCAGATCTCTTGG - Intronic
990933562 5:61121607-61121629 TAGTATTTCACCAAATATCTGGG - Intronic
991157663 5:63458389-63458411 CAGAATAAGACCCACTAGCTTGG + Intergenic
991167762 5:63583557-63583579 CAGAGTAACAGCAGATCTCTCGG + Intergenic
991323843 5:65407268-65407290 CAGACTAACAGCAGATCTCTCGG + Intronic
991545974 5:67781792-67781814 CAGACTAACGGCAGATATCTCGG + Intergenic
991576018 5:68104010-68104032 CAGACTAACAGCAGATCTCTCGG + Intergenic
991652264 5:68867052-68867074 CAGACTAACAGCAGATCTCTAGG + Intergenic
992078056 5:73208850-73208872 CAGACTAACAGCAGATCTCTTGG + Intergenic
992274501 5:75101283-75101305 CAGACTAACAGCAGATCTCTTGG - Intronic
992360807 5:76036603-76036625 CAGACTAACAGCAGATCTCTCGG - Intergenic
992513755 5:77470061-77470083 CAGACTAACAGCAGATCTCTTGG + Intronic
992604259 5:78439573-78439595 CAGACTAACAGCAGATCTCTCGG - Intronic
992619983 5:78583641-78583663 CAGACTAACAGCAGATCTCTTGG - Intronic
992650202 5:78852415-78852437 CAGACTAACAGCAGATCTCTTGG - Intronic
992820714 5:80493413-80493435 CAGAATAACAGCAATTTTCAGGG + Intronic
992873664 5:81030433-81030455 CAGATTAACAGCAGATCTCTTGG + Intronic
992965833 5:81998980-81999002 CAGAAAACTACCAAATATTTGGG + Intronic
993151148 5:84163515-84163537 CAAAAATACACTAAATATCTTGG + Intronic
993244453 5:85433227-85433249 CAGACTAACAGCAGATCTCTTGG + Intergenic
993323309 5:86502778-86502800 CAGAATAACTTCAAATTACTGGG - Intergenic
993471022 5:88307517-88307539 CAGACTAACAGCAGATCTCTTGG + Intergenic
993474668 5:88350017-88350039 CAGACTAACAGCAGATCTCTCGG - Intergenic
993619259 5:90148527-90148549 CAGACTAACAGCAGATCTCTTGG + Intergenic
993627199 5:90240020-90240042 CAGACTAACAGCAGATCTCTTGG + Intergenic
993758631 5:91763782-91763804 CAGACTAACAGCAGATCTCTTGG + Intergenic
993888449 5:93443833-93443855 CAGACTAACAGCAGATCTCTTGG + Intergenic
993947831 5:94136809-94136831 CAGACTAACAGCAGATCTCTCGG - Intergenic
994263148 5:97683615-97683637 CAGACTAACAGCAGATCTCTTGG - Intergenic
994266410 5:97722145-97722167 CAGACTAACAGCAGATCTCTTGG - Intergenic
994387381 5:99147977-99147999 CAGACTAACAGCAGATCTCTTGG + Intergenic
994444647 5:99857562-99857584 CAGACTAACAGCAGATCTCTCGG + Intergenic
994806169 5:104450738-104450760 CAGACTAACAGCAGATCTCTCGG - Intergenic
994829466 5:104760253-104760275 CAAAATACAACCAAATAGCTGGG + Intergenic
994847188 5:105004343-105004365 CAGACTAACACCTGATCTCTCGG + Intergenic
994948739 5:106429743-106429765 CAGACTAACAGCAGATCTCTCGG - Intergenic
995002886 5:107157332-107157354 CAAAATAACTTCAAATATATTGG - Intergenic
995459927 5:112391858-112391880 CAGACTAACAGCAGATCTCTCGG + Intronic
995564053 5:113415125-113415147 CAGACTAACAGCAGATCTCTCGG - Intronic
995676920 5:114672515-114672537 CAGACTAACAGCAGATCTCTTGG + Intergenic
995699083 5:114913686-114913708 CAGATTAACAGCAGATTTCTTGG + Intergenic
995713548 5:115059257-115059279 CAGACTAACAGCAGATCTCTTGG - Intergenic
995931010 5:117444150-117444172 CAAAATAACAACATATATTTTGG - Intergenic
996636489 5:125695675-125695697 CTGAATACCACCAAACATATTGG - Intergenic
996782151 5:127198919-127198941 CAGACTAACAGCAGATCTCTCGG + Intergenic
997087595 5:130819379-130819401 CAGACTAACAGCAGATTTCTCGG + Intergenic
997136884 5:131336329-131336351 CAGACTAACAGCAGATCTCTCGG - Intronic
997137912 5:131345782-131345804 CAGACTAACAGCAGATCTCTTGG + Intronic
997313687 5:132913883-132913905 CAGAAAATCTCCAAATATTTGGG + Intronic
997807446 5:136933078-136933100 CAGACTAACAGCAGATCTCTTGG + Intergenic
998247106 5:140516572-140516594 CAGACTAACAGCAGATCTCTCGG + Intronic
998626668 5:143853841-143853863 CAGACTAACAGCAGATCTCTCGG + Intergenic
998969958 5:147580385-147580407 CAGAATAACAGCAATTTTCAGGG + Intergenic
999003106 5:147945470-147945492 CAGACTAACAGCAGATCTCTCGG - Intergenic
999214879 5:149924266-149924288 CAGAAGAAGAACAAATATATTGG + Intronic
999457545 5:151730069-151730091 CAGAATAACAGCAATTTTCAGGG - Intergenic
999568290 5:152890818-152890840 CAGACTAACAGCAGATCTCTCGG - Intergenic
999584432 5:153075346-153075368 CAGACTAACAGCAGATCTCTCGG - Intergenic
999963670 5:156784589-156784611 CAGACTAACAACAGATCTCTTGG + Intergenic
1000033770 5:157426098-157426120 CAGATTAACAGCAGATCTCTTGG + Intronic
1000119524 5:158183359-158183381 CAGACTAACAGCAGATCTCTCGG + Intergenic
1000461681 5:161529413-161529435 CAGAAGAACACAAAATAAATGGG + Intronic
1000644377 5:163743067-163743089 GGGAATAACACCAAATATCATGG - Intergenic
1000880662 5:166693222-166693244 CAGAATAACACCAATTGTCAGGG - Intergenic
1001076549 5:168632515-168632537 CAGAATAACAGCAGATCTCTTGG + Intergenic
1001372929 5:171224505-171224527 CAGAATAATGCCAAATCTATGGG + Intronic
1002011240 5:176283307-176283329 CAGACTAACAGCTAATCTCTTGG + Intronic
1002232157 5:177773892-177773914 CAGACTAACAGCAGATCTCTCGG + Intronic
1002945032 6:1752669-1752691 CAGACTAACAGCAGATCTCTCGG + Intronic
1003228837 6:4230796-4230818 CAGACTAACAGCAGATCTCTCGG + Intergenic
1003413802 6:5890565-5890587 CAGACTAACAGCAGATCTCTTGG - Intergenic
1003813612 6:9812395-9812417 CAGACTAACAGCAGATTTCTCGG + Intronic
1003819882 6:9884083-9884105 CAGACTAACAGCAGATCTCTCGG + Intronic
1004235049 6:13867953-13867975 CAGAAGAACCCAAACTATCTTGG - Intergenic
1005156719 6:22815201-22815223 CACAATAAAATCAAATACCTAGG - Intergenic
1005239335 6:23805697-23805719 CAGACTAACAGCAGATCTCTCGG + Intergenic
1005263345 6:24084618-24084640 CAGACTAACAGCAGATCTCTCGG + Intergenic
1005663308 6:28022533-28022555 CAGACTAACAGCAGATCTCTCGG + Intergenic
1005664456 6:28037365-28037387 CAGAATTACCCCAAATTTGTGGG - Intergenic
1005747368 6:28850546-28850568 CAGACTAACAGCAGATCTCTTGG + Intergenic
1007134767 6:39510014-39510036 CAGACTAACAGCAGATGTCTTGG + Intronic
1007137346 6:39534845-39534867 CAGACTAACAGCAGATCTCTTGG + Intronic
1007354970 6:41307972-41307994 CAGAAAAACTCCAAATAACAGGG + Intergenic
1007978031 6:46121214-46121236 CAGACTAACAGCTAATCTCTCGG + Intergenic
1008254334 6:49277545-49277567 CAGACTAACAGCAGATCTCTTGG + Intergenic
1008281429 6:49600321-49600343 CAGACTAACAGCAGATCTCTTGG + Intergenic
1008329439 6:50227664-50227686 CAGACTAACAGCAGATCTCTTGG - Intergenic
1008798926 6:55342307-55342329 CAGACTAACAGCAGATCTCTCGG + Intronic
1008898825 6:56587694-56587716 CAGACTAACAGCAGATCTCTCGG + Intronic
1008915616 6:56784083-56784105 CAGACTAACAGCAGATCTCTCGG - Intronic
1009290279 6:61871638-61871660 CAGACTAACAGCAGATCTCTCGG + Intronic
1009499359 6:64391408-64391430 CAGACTAACAGCAGATCTCTCGG + Intronic
1009789620 6:68385267-68385289 CAGAATAACAGCAATTTTCAGGG + Intergenic
1009870151 6:69443899-69443921 CAGACTAACAGCAGATCTCTTGG - Intergenic
1010019438 6:71141980-71142002 CAGACTAACAGCAGATCTCTCGG + Intergenic
1010463644 6:76142087-76142109 CAGACTAACAGCAGATCTCTTGG - Intergenic
1010465021 6:76157753-76157775 CAGAATAACAGCAATTTTCAGGG + Intergenic
1010503296 6:76627497-76627519 CAGACTAACAGCACATCTCTTGG - Intergenic
1010530371 6:76960621-76960643 CAGACTAACAGCAGATTTCTCGG + Intergenic
1010540465 6:77086835-77086857 CAGACTAACAGCAGATCTCTCGG - Intergenic
1010615532 6:78007323-78007345 CAGACTAACAGCAGATCTCTCGG + Intergenic
1010681608 6:78806001-78806023 CAGACTAACAGCAGATCTCTTGG - Intergenic
1010718287 6:79255656-79255678 CAGACTAACAGCAGATCTCTCGG - Intergenic
1010727193 6:79348543-79348565 CAGACTAACAGCAGATCTCTTGG + Intergenic
1010959412 6:82128541-82128563 CAGACTAACAGCAGATCTCTCGG - Intergenic
1011089155 6:83575857-83575879 TAGAATAACAACAAAAATCTGGG + Intronic
1011118266 6:83920691-83920713 AAGATGAACAACAAATATCTTGG + Intronic
1011227414 6:85122910-85122932 GAGAAGGACTCCAAATATCTTGG + Intergenic
1011244334 6:85306583-85306605 CAGACTAACAGCAGATCTCTCGG - Intergenic
1011308613 6:85957264-85957286 CAGACTAACAGCAGATCTCTCGG - Intergenic
1011364959 6:86571346-86571368 CAGACTAACAGCAGATCTCTCGG + Intergenic
1011392993 6:86874602-86874624 CAGACTAACAGCAGATCTCTCGG + Intergenic
1011397304 6:86922941-86922963 CAGACTAACAGCAGATCTCTTGG + Intergenic
1011538837 6:88408143-88408165 CAGACTAACAGCAGATCTCTCGG + Intergenic
1011671001 6:89682956-89682978 CAGAATAAGGCAAAAAATCTTGG - Intronic
1012204018 6:96438388-96438410 CAGACTAACAGCAGATCTCTTGG + Intergenic
1012269131 6:97186066-97186088 CAGAATGACACTGAATATATAGG - Intronic
1012459892 6:99448809-99448831 CAGACTAACAGCAGATCTCTTGG + Intronic
1012608766 6:101189913-101189935 CAGACTAACAGCAGATCTCTTGG + Intergenic
1012673810 6:102089841-102089863 CAGACTAACAGCAGATCTCTCGG + Intergenic
1012719550 6:102723751-102723773 CAGACTAACAGCAGATCTCTCGG + Intergenic
1012776080 6:103495526-103495548 CAGACTAACAGCAGATCTCTCGG - Intergenic
1012904704 6:105050683-105050705 CAGACTAACAGCAGATCTCTCGG - Intronic
1013200528 6:107890927-107890949 CAGACTAACAGCAGATCTCTTGG - Intronic
1013614796 6:111832270-111832292 CAGAAAAATATGAAATATCTAGG - Intronic
1013622827 6:111907355-111907377 CAGACTAACAGCAGATCTCTCGG - Intergenic
1013715252 6:112952966-112952988 CCAAAAAACCCCAAATATCTAGG - Intergenic
1013874209 6:114804267-114804289 CAGACTAACAGCAGATCTCTCGG - Intergenic
1013902714 6:115176872-115176894 CAGACTAACAGCAGATCTCTTGG + Intergenic
1013939784 6:115646946-115646968 CAGACTAACAGCAGATCTCTTGG + Intergenic
1014013464 6:116502658-116502680 CAGACTAACAGCAGATTTCTTGG + Intronic
1014185405 6:118428579-118428601 CAGACTAACAGCAGATCTCTTGG + Intergenic
1015056539 6:128909995-128910017 CAGACTAACAGCAGATCTCTCGG - Intronic
1015197552 6:130540371-130540393 CAGACTAACAGCCAATCTCTCGG + Intergenic
1015369411 6:132434166-132434188 AAGATTAACACCATATATCTGGG - Intergenic
1015967540 6:138710265-138710287 CAGACTAACAGCAGATCTCTTGG - Intergenic
1016020143 6:139228694-139228716 CAGAAAAAAACCCAATAGCTAGG + Intergenic
1016089356 6:139956970-139956992 CTAAAACACACCAAATATCTAGG + Intergenic
1016138794 6:140582506-140582528 CAGACTAACAGCAGATTTCTGGG + Intergenic
1016523720 6:144976082-144976104 CAGACTAACAGCAGATTTCTTGG - Intergenic
1016552923 6:145301939-145301961 CAGACTAACAGCAGATCTCTTGG - Intergenic
1016742880 6:147546971-147546993 GAGAATAACACCATACAGCTGGG + Intronic
1016855452 6:148666046-148666068 CAGAATAACAGCAATTTTCAGGG + Intergenic
1017660098 6:156665284-156665306 CAGACTAACAGCAGATCTCTTGG + Intergenic
1017968510 6:159288904-159288926 CAGACTAACAGCAGATCTCTTGG - Intergenic
1018175641 6:161177000-161177022 CAGACTAACAGCAGATCTCTCGG - Intronic
1018500073 6:164398242-164398264 CAGAATATTAGGAAATATCTTGG + Intergenic
1018527185 6:164725596-164725618 CAGACTAACAGCAGATCTCTTGG + Intergenic
1018586826 6:165369861-165369883 CAGACTAACAGCAAATCTCTCGG + Intronic
1019315877 7:386341-386363 CAAAAAAACACAAAATGTCTGGG + Intergenic
1020344014 7:7143953-7143975 CAGACTAACAGCAGATCTCTTGG - Intergenic
1020549871 7:9590090-9590112 CAGAAAAACAGCAGATATTTGGG + Intergenic
1020795731 7:12676679-12676701 CAGACTAACAGCAGATCTCTTGG + Intergenic
1020818629 7:12938432-12938454 CAGACTAACAGCAGATCTCTTGG - Intergenic
1020925743 7:14321810-14321832 CTGTTAAACACCAAATATCTAGG + Intronic
1021208052 7:17808738-17808760 CAGACTAACAGCAGATCTCTTGG + Intronic
1021319525 7:19193407-19193429 CAGACTAACAGCGAATCTCTTGG - Intergenic
1021618800 7:22529943-22529965 CAGACTAACAGCAGATCTCTCGG + Intronic
1021765962 7:23948942-23948964 CAGACTAACAGCAGATCTCTCGG + Intergenic
1021798010 7:24277339-24277361 CAGACTAACAGCAGATCTCTCGG - Intergenic
1021870384 7:25000605-25000627 CAGACTAACAGCAGATCTCTTGG - Intergenic
1022132069 7:27414099-27414121 CAGAATCACGCCCAATACCTTGG - Intergenic
1022464107 7:30641169-30641191 CAGACTAACAGCAGATCTCTCGG - Intergenic
1022576778 7:31505559-31505581 CAGACTAACAGCAGATCTCTCGG - Intergenic
1022696374 7:32709779-32709801 CAGACTAACAGCAGATCTCTCGG + Intergenic
1022882112 7:34598872-34598894 TAGAAAAACATCAAATATTTTGG - Intergenic
1022901587 7:34815699-34815721 CAGACTAACAGCAGATCTCTTGG + Intronic
1023065890 7:36377459-36377481 CAGAATAACAGCAGATCTCTTGG - Intronic
1023476162 7:40580047-40580069 CATAATAAAACTAGATATCTAGG - Intronic
1023509230 7:40933291-40933313 CAGACTAACAGCAGATCTCTCGG - Intergenic
1023533652 7:41184985-41185007 AAGTATAAAACAAAATATCTAGG + Intergenic
1023671753 7:42584930-42584952 CAGACTAACAGCAGATCTCTTGG - Intergenic
1024092020 7:45951758-45951780 CAGACTAACAGCAGATCTCTCGG - Intergenic
1024386413 7:48756952-48756974 AAGAATATTTCCAAATATCTGGG - Intergenic
1024419247 7:49142812-49142834 CAGACTAACAGCAGATCTCTTGG - Intergenic
1024892517 7:54219888-54219910 CAGACTAACAGCAGATCTCTAGG + Intergenic
1025577684 7:62668627-62668649 CAGACTAACAGCAGATTTCTCGG + Intergenic
1026488340 7:70839959-70839981 CAGACTAACAGCAGATCTCTTGG + Intergenic
1026669314 7:72374185-72374207 CAAAATAAAAGGAAATATCTAGG + Intronic
1027574664 7:79916858-79916880 CAGAATAACAGCGGATCTCTCGG + Intergenic
1028050218 7:86175704-86175726 CAGACTAACAGCAGATCTCTCGG + Intergenic
1028062692 7:86341853-86341875 CAGACTAACAGCAGATCTCTCGG + Intergenic
1028080491 7:86568961-86568983 CAGACTAACAGCAGATCTCTTGG + Intergenic
1028252664 7:88555398-88555420 CAGACTAACAGCAGATCTCTTGG - Intergenic
1028331620 7:89601524-89601546 CAGAATAACAGCAATTTTCAGGG - Intergenic
1028412830 7:90549747-90549769 CAGACTAACAGCAGATCTCTCGG - Intronic
1028450278 7:90974240-90974262 CAGAATAACAGCAATTTTCAGGG - Intronic
1028499988 7:91508487-91508509 CAGACTAACAGCAGATCTCTTGG + Intergenic
1028643676 7:93072170-93072192 CAGACTAACAGCAGATCTCTTGG - Intergenic
1028647094 7:93110090-93110112 CAGATTAACAGCAGATCTCTTGG + Intronic
1028665947 7:93343616-93343638 CAGACTAACAGCAGATCTCTCGG + Intronic
1028867972 7:95735841-95735863 CAGGCTAACTCCAAATACCTGGG + Intergenic
1029064643 7:97837322-97837344 CAGATTAACAGAAATTATCTAGG + Intergenic
1029808191 7:103018107-103018129 CAGAATAACAGCGGATCTCTTGG + Intronic
1030177905 7:106673516-106673538 CAGACTAACAGCAGATCTCTCGG + Intergenic
1030197907 7:106870191-106870213 CAGAATAATATCTCATATCTGGG + Intronic
1030286425 7:107831688-107831710 CAGAATAACATTAAATATGGAGG + Intergenic
1030426223 7:109382289-109382311 CAGAATAACATCTGATCTCTCGG + Intergenic
1030517995 7:110561895-110561917 CAGACTAACAGCAGATCTCTTGG - Intergenic
1030809677 7:113957786-113957808 CAGAATAAGACCCACTGTCTTGG - Intronic
1030850864 7:114485687-114485709 CAGAATAATCCCAAAAATGTAGG - Intronic
1030905049 7:115172119-115172141 CAGACTAACAGCAGATCTCTCGG - Intergenic
1031708654 7:125015881-125015903 CAAAATAAGACCAAAGATATGGG - Intergenic
1032377874 7:131441899-131441921 CTCAATCACTCCAAATATCTGGG - Intronic
1032925420 7:136598897-136598919 CAGACTAACAGCAGATCTCTCGG + Intergenic
1032972695 7:137183255-137183277 CAGAATAACAGCGGATCTCTTGG + Intergenic
1033401967 7:141034247-141034269 CAGACTAACAGCAGATCTCTCGG + Intergenic
1033498566 7:141925045-141925067 CAGAATAACAGCGGATCTCTCGG - Intronic
1033863561 7:145660335-145660357 CAGACTAACAGCAGATCTCTCGG + Intergenic
1034058698 7:148066141-148066163 CAGATTAACAGCAGATTTCTCGG - Intronic
1034139731 7:148804348-148804370 CTGTAGAACACCAAACATCTGGG + Intergenic
1034208794 7:149344188-149344210 CAGATTAACAGCAGATCTCTCGG - Intergenic
1034236770 7:149578162-149578184 CAGACTAACAACAGATCTCTCGG - Intergenic
1034555376 7:151847176-151847198 CAGAATAACACTAGACATCAGGG - Intronic
1034696970 7:153062484-153062506 CAGATTAACACAATTTATCTTGG + Intergenic
1036580390 8:10069007-10069029 CAAAAAAACACGAAATATTTTGG - Intronic
1036745550 8:11406416-11406438 CAGACTAACAGCAGATCTCTCGG - Intronic
1037542237 8:19883340-19883362 CACAGAAACACCGAATATCTGGG + Intergenic
1037545277 8:19914351-19914373 CAGACTAACAGCAGATCTCTTGG - Intronic
1038107504 8:24453009-24453031 CAGACTAACAGCAGATCTCTCGG - Intronic
1038116404 8:24560470-24560492 CAGACTAACAGCAGATCTCTCGG + Intergenic
1038221574 8:25613709-25613731 CAGACTAACAGCAGATCTCTTGG - Intergenic
1038873142 8:31518490-31518512 CAGACTAACAGCAGATATCTCGG - Intergenic
1038902114 8:31855971-31855993 CAGACTAACAGCAGATCTCTCGG - Intronic
1039079922 8:33723883-33723905 CAGAAAATCATCAAATATTTTGG - Intergenic
1039146180 8:34450098-34450120 CAGACTAACAGCAGATCTCTCGG - Intergenic
1039331072 8:36537110-36537132 CAGAATAACAGCAATTTTCAGGG - Intergenic
1039342857 8:36670738-36670760 CAGACTAACAGCAGATCTCTTGG - Intergenic
1039633885 8:39142561-39142583 CAGACTAACAGCAGATCTCTCGG - Intronic
1039767796 8:40648707-40648729 CAGACTAACAGCAGATCTCTCGG + Intronic
1039832535 8:41226751-41226773 CAGACTAACAGCAGATCTCTCGG + Intergenic
1040085186 8:43332633-43332655 CAGACTAACAGCAGATCTCTTGG - Intergenic
1040363857 8:46693564-46693586 CAGACTAACAGCAGATCTCTCGG + Intergenic
1040540840 8:48353485-48353507 CAGACTAACAGCAGATCTCTTGG + Intergenic
1040591598 8:48798264-48798286 CAGACTAACAGCAGATCTCTCGG - Intergenic
1040612532 8:48999370-48999392 CAGACTAACAGCTGATATCTCGG + Intergenic
1040962276 8:53047507-53047529 CAGAATAACAGCTGATCTCTCGG - Intergenic
1041078082 8:54187364-54187386 CAGACTAAAAGCAAATATCAAGG - Intergenic
1041122980 8:54606401-54606423 CAGAGTAACAGCAGATCTCTCGG - Intergenic
1041161730 8:55051623-55051645 CAGACTAACAGCAGATCTCTCGG + Intergenic
1041287449 8:56275102-56275124 CAGAATAACAGCAATTTTCAGGG + Intergenic
1041294651 8:56342526-56342548 AAGAAAAACACCAAATATATGGG + Intergenic
1041414930 8:57597568-57597590 CAGGATAACAGCAAATTTCAGGG + Intergenic
1041557333 8:59173018-59173040 CAGACTAACAGCAGATCTCTCGG - Intergenic
1041613033 8:59874162-59874184 CAGACTAACAGCAGATCTCTCGG - Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042195775 8:66230301-66230323 CAGACTAACACCAGATCCCTTGG + Intergenic
1042471749 8:69197355-69197377 CAAAAAAACACAAAATATCAAGG + Intergenic
1042478998 8:69281971-69281993 CAGACTAACAGCAGATCTCTTGG + Intergenic
1042780085 8:72481078-72481100 CAGACTAACAGCAGATCTCTCGG + Intergenic
1042821769 8:72937274-72937296 CAGAAGAGCACCAAAGAGCTAGG + Exonic
1042833629 8:73057538-73057560 CAGACTAACAGCAGATCTCTCGG + Intergenic
1042987233 8:74598589-74598611 CAGACTAACAGCGGATATCTTGG - Intergenic
1043009903 8:74868169-74868191 CAGACTAACAGCGGATATCTTGG + Intergenic
1043034078 8:75175372-75175394 CAGAATAACAGCAATTTTCAGGG - Intergenic
1043102542 8:76064239-76064261 CAGACTAACAGCAGATCTCTCGG + Intergenic
1043165689 8:76900433-76900455 CAGACTAACAGCAGATCTCTTGG - Intergenic
1043279595 8:78446624-78446646 CAGACTAACAGCAGATCTCTTGG + Intergenic
1043725325 8:83603491-83603513 CAGAATAAAAGCAGATCTCTCGG + Intergenic
1043726789 8:83621651-83621673 CAGACTAACAGCAGATCTCTTGG - Intergenic
1043787726 8:84423908-84423930 CAGACTAACAGCAGATCTCTCGG - Intronic
1043791059 8:84468502-84468524 CAGACTAACAGCAGATCTCTCGG - Intronic
1043995102 8:86804708-86804730 CAGACTAACAGCAGATCTCTCGG - Intergenic
1044225169 8:89709956-89709978 CAGACTAACAGCAGATCTCTCGG + Intergenic
1044353693 8:91196203-91196225 CAGACTAACAGCAGATCTCTCGG - Intronic
1044440669 8:92220425-92220447 CAGACTAACAGCAGATCTCTTGG - Intergenic
1044449020 8:92312541-92312563 CAGACTAACAGCAGATCTCTTGG - Intergenic
1044576788 8:93778712-93778734 CAGACTAACAGCAGATTTCTTGG - Intronic
1044601279 8:94007981-94008003 CAGAATAACAGCTGATCTCTCGG - Intergenic
1044882881 8:96742834-96742856 CAGACTAACAGCAGATCTCTCGG - Intronic
1044936424 8:97297246-97297268 CAGACTAACAGCAGATCTCTCGG + Intergenic
1045201919 8:99991899-99991921 CAGACTAACAGCAGATCTCTTGG + Intronic
1045586991 8:103549253-103549275 CAGACTAACAGCAGATCTCTTGG + Intronic
1045606880 8:103787630-103787652 CAGACTAACAGCAGATCTCTCGG - Intronic
1045783868 8:105898814-105898836 CAGACTAACAGCAGATCTCTCGG + Intergenic
1045898136 8:107242249-107242271 CAGACTAACAGCAGATCTCTTGG + Intergenic
1045954799 8:107894237-107894259 CAGACTAACAGCAGATGTCTCGG - Intergenic
1046203145 8:110953273-110953295 CAGACTAACAGCAGATCTCTCGG + Intergenic
1046609968 8:116412101-116412123 CAGACTAACAGCAGATCTCTTGG + Intergenic
1046894660 8:119460558-119460580 CAGACTAACAGCAGATCTCTCGG - Intergenic
1046896377 8:119478227-119478249 CAGACTAACAGCAGATCTCTCGG - Intergenic
1047008708 8:120648525-120648547 CAGACTAACAGCAGATGTCTCGG - Intronic
1047157020 8:122331027-122331049 CAGACTAACAGCAGATCTCTCGG - Intergenic
1047592668 8:126343230-126343252 CAGACTAACAGCAGATCTCTCGG + Intergenic
1047686829 8:127313225-127313247 CAGACTAACAGCAGATCTCTCGG + Intergenic
1047845730 8:128802994-128803016 CAGAATAATAGCAGATCTCTCGG + Intergenic
1047854544 8:128895845-128895867 CAGACTAACAGCAGATCTCTCGG - Intergenic
1048138829 8:131772548-131772570 CAGACTAACAGCAGATCTCTCGG + Intergenic
1048456220 8:134580679-134580701 CAGAATTAGACCCAATATCTTGG + Intronic
1050224664 9:3439023-3439045 TAGAATATCCCCAAATATTTTGG + Intronic
1050300298 9:4251963-4251985 CAGACTAACAGCAGATCTCTCGG - Intronic
1050320876 9:4450631-4450653 CAGACTAACAGCAGATCTCTTGG + Intergenic
1050322622 9:4468418-4468440 CAGACTAACAGCAGATCTCTTGG + Intergenic
1050381336 9:5033523-5033545 CAGACTAACAGCAGATCTCTTGG + Intronic
1050486293 9:6137491-6137513 CAGACTAACAGCAGATCTCTCGG + Intergenic
1050603990 9:7282042-7282064 CAGACTAACAGCAGATCTCTCGG - Intergenic
1050688274 9:8196802-8196824 CACAAAATCACCAGATATCTAGG + Intergenic
1050824862 9:9932860-9932882 CAGACTAACAGCAGATCTCTCGG + Intronic
1050961332 9:11736921-11736943 CAGAATACAAACAAATATGTGGG - Intergenic
1051060507 9:13039530-13039552 CAGACTAACAGCAGATCTCTTGG + Intergenic
1051205247 9:14681823-14681845 CAGACTAACAGCAGATCTCTTGG + Intronic
1051324515 9:15950406-15950428 CAGACTAACAGCAGATGTCTTGG + Intronic
1051452617 9:17214413-17214435 CAGAATAACAGCAGATCTCCTGG - Intronic
1051479240 9:17541206-17541228 CAGACTAACAGCAGATATCTCGG + Intergenic
1051745617 9:20292203-20292225 CAGGAAGACACCAACTATCTGGG - Intergenic
1051928080 9:22353195-22353217 CAGACTAACAGCAGATCTCTCGG - Intergenic
1052513629 9:29452354-29452376 CAGACTAACAGCAGATCTCTCGG + Intergenic
1052612111 9:30789410-30789432 CAGACTAACAGCAGATCTCTCGG - Intergenic
1052718967 9:32150719-32150741 CAGACTAACAGCAGATCTCTCGG + Intergenic
1053084105 9:35203516-35203538 CAGACTAACAGCAGATCTCTTGG - Intronic
1053699919 9:40680037-40680059 CAGACTAACAGCAGATCTCTTGG - Intergenic
1054311210 9:63479436-63479458 CAGACTAACAGCAGATCTCTTGG - Intergenic
1054347495 9:63981449-63981471 CAGACTAACAGCAGATCTCTTGG + Intergenic
1054409993 9:64803588-64803610 CAGACTAACAGCAGATCTCTTGG - Intergenic
1055229347 9:74042777-74042799 CAGAATAAAATAAAATTTCTTGG - Intergenic
1055325954 9:75129864-75129886 CTTAATATCATCAAATATCTAGG - Intronic
1055346450 9:75344931-75344953 CAGACTAACAGCAGATCTCTCGG - Intergenic
1055628936 9:78202705-78202727 CAGACTAACAGCAGATCTCTTGG + Intergenic
1055714436 9:79102211-79102233 CAGACTAACAGCAGATCTCTCGG - Intergenic
1055715713 9:79115738-79115760 GTGATTAAAACCAAATATCTTGG + Intergenic
1055745608 9:79440606-79440628 CAGACTAACAGCAGATCTCTCGG + Intergenic
1055853359 9:80658474-80658496 CAGACTAACAGCAGATCTCTTGG - Intergenic
1055860657 9:80746025-80746047 CAGACTAACAGCAGATCTCTTGG - Intergenic
1056166249 9:83943641-83943663 CAGAATAACACAGAATATAAAGG - Intronic
1056582701 9:87903879-87903901 CAGACTAACAGCAGATCTCTCGG + Intergenic
1056727143 9:89129540-89129562 CAGACTAACAGCAGATCTCTCGG + Intronic
1057086596 9:92216055-92216077 CAGACTAACAGCAGATCTCTCGG + Intronic
1057322183 9:94024701-94024723 CAGACTAACAGCAGATCTCTTGG - Intergenic
1057342865 9:94218515-94218537 CAGACTAACAGCAGATCTCTTGG + Intergenic
1058012173 9:99990297-99990319 CAGACTAACAGCGGATATCTCGG + Intronic
1058036363 9:100257766-100257788 CAGACTAACAGCAGATCTCTTGG - Intronic
1058064037 9:100528874-100528896 CAGACTAACAGCAGATCTCTCGG + Intronic
1058072688 9:100617979-100618001 CAGACTAACAGCAGATCTCTTGG - Intergenic
1058080143 9:100692360-100692382 CAGACTAACAGCAGATCTCTTGG + Intergenic
1058188602 9:101886176-101886198 CAGGATAATCTCAAATATCTGGG + Intergenic
1058209668 9:102152104-102152126 CAGACTAACAGCAGATCTCTCGG - Intergenic
1058557521 9:106185981-106186003 CAGACTAACAGCAGATCTCTCGG - Intergenic
1058563820 9:106259717-106259739 CAGACTAACAGCAGATCTCTTGG - Intergenic
1059105906 9:111511443-111511465 CAGAATAACAGCAATTTTCAGGG + Intergenic
1059550287 9:115222279-115222301 CATTATAACACCAGATGTCTAGG + Intronic
1059708306 9:116843858-116843880 CAGAATCACACAATATATCCAGG + Intronic
1059922135 9:119170764-119170786 CAGACTAACAGCAGATCTCTCGG + Intronic
1059967035 9:119625687-119625709 CAGACTAACAGCAGATCTCTCGG - Intergenic
1060166315 9:121419451-121419473 CAGACTAACAGCAGATCTCTCGG - Intergenic
1060306001 9:122412986-122413008 CAGACTAACAGCAGATCTCTTGG - Intergenic
1061500227 9:130997678-130997700 CAGAATAACCCCCCAAATCTGGG - Intergenic
1061833452 9:133311658-133311680 CAGACTAACAGCAGATCTCTCGG + Intergenic
1203380253 Un_KI270435v1:30002-30024 CAGACTAACAGCAGATCTCTTGG + Intergenic
1203399663 Un_KI270519v1:74509-74531 CAGACTAACAGCAGATCTCTCGG + Intergenic
1185658645 X:1708124-1708146 CAGACTAACAGCAGATCTCTCGG - Intergenic
1186354402 X:8774726-8774748 CAGACTAACAGCAGATCTCTCGG + Intergenic
1186662086 X:11678788-11678810 AAAAATAACACAAAATATTTGGG - Intergenic
1186711445 X:12201951-12201973 CAGAAAGACAACAAATCTCTAGG - Intronic
1186956403 X:14687162-14687184 CAGACTAACAGCAGATCTCTTGG - Intronic
1187105217 X:16235058-16235080 CAGACTAACAGCAGATCTCTTGG - Intergenic
1187113313 X:16323419-16323441 CAGACTAACAGCAGATCTCTTGG + Intergenic
1187116972 X:16361837-16361859 CAGACTAACAGCAGATCTCTTGG + Intergenic
1187130639 X:16499115-16499137 CAGACTAACAGCAGATCTCTTGG + Intergenic
1187422684 X:19149934-19149956 CATAAAAACTCCAAAAATCTTGG + Intergenic
1188040366 X:25364963-25364985 CAGATTAACAACAGATTTCTCGG - Intergenic
1188084331 X:25884117-25884139 CAGACTAACAGCACATCTCTCGG + Intergenic
1188119350 X:26285660-26285682 CAGACTAACAACAGATGTCTCGG - Intergenic
1188123271 X:26335774-26335796 CAGACTAACAACAGATCTCTCGG + Intergenic
1188400743 X:29740947-29740969 CAGAATAACAACAGAAATCTAGG - Intronic
1188959128 X:36469548-36469570 CAGACTAACAGCAGATCTCTCGG - Intergenic
1189065676 X:37805814-37805836 CACAATAAAACCAAATTTATAGG - Intronic
1189603606 X:42652473-42652495 CAGAATAACAGCTGATCTCTCGG + Intergenic
1189645418 X:43123936-43123958 TGGAATAACCCCAAATATTTGGG - Intergenic
1189937957 X:46088902-46088924 CAGACTAACAACGAATCTCTCGG + Intergenic
1190403406 X:50061790-50061812 CAGACTAACAGCAGATCTCTCGG + Intronic
1190607705 X:52161688-52161710 CAGACTAACACCTGATCTCTTGG + Intergenic
1190649203 X:52552510-52552532 CAGACTAACAGCAGATCTCTTGG + Intergenic
1190850807 X:54239572-54239594 CAGAAAAAAACAAGATATCTAGG + Intronic
1191060694 X:56292728-56292750 CAGACTAACAGCTGATATCTCGG + Intergenic
1191087556 X:56585880-56585902 CAGACTAACAGCAGATGTCTCGG - Intergenic
1191209007 X:57864931-57864953 CAGACTAACAGCAGATCTCTCGG + Intergenic
1191596272 X:62947350-62947372 CAGACTAACAGCAGATCTCTTGG + Intergenic
1191656136 X:63601553-63601575 CAGACTAACAGCAGATCTCTCGG - Intergenic
1191762435 X:64660565-64660587 CAGACTAACATCAGATCTCTTGG - Intergenic
1191809344 X:65170392-65170414 CAGACTAACAGCAGATCTCTCGG - Intergenic
1191814824 X:65231742-65231764 CAGAATAACAGCAATTTTCAGGG - Intergenic
1191828110 X:65387999-65388021 CAGACTAACAGCAGATATCTCGG - Intronic
1191855109 X:65619066-65619088 CAGACTAACAGCAGATCTCTCGG - Intronic
1192041834 X:67630998-67631020 CAGACTAACAGCAGATCTCTCGG - Intronic
1192061487 X:67831702-67831724 CAGACTAACAGCAGATCTCTTGG + Intergenic
1192132335 X:68564157-68564179 CAGACTAACAACAGATCTCTCGG - Intergenic
1192135550 X:68595882-68595904 CACAATAAAATAAAATATCTAGG + Intergenic
1192616775 X:72632990-72633012 CAGAATAAAACTAAAGATCTAGG - Intronic
1192683884 X:73283128-73283150 CAGACTAACAGCAGATCTCTCGG + Intergenic
1192715983 X:73643226-73643248 CAGACTAACAGCAGATCTCTCGG - Intronic
1192719298 X:73676090-73676112 CAGACTAACAGCAGATCTCTCGG - Intronic
1192871647 X:75190336-75190358 CAGACTAACAGCAGATCTCTCGG - Intergenic
1192906686 X:75559518-75559540 CAGACTAACAGCAGATCTCTCGG - Intergenic
1192907324 X:75565633-75565655 CAGACTAACAGCAGATCTCTCGG - Intergenic
1193038621 X:76980379-76980401 CAGACTAACAGCAGATCTCTTGG + Intergenic
1193157624 X:78190625-78190647 CAGACTAACAGCAGATCTCTCGG + Intergenic
1193189301 X:78550430-78550452 CAGACTAACAGCAGATCTCTTGG + Intergenic
1193229813 X:79030953-79030975 CAGACTAACAGCAGATCTCTTGG - Intergenic
1193364991 X:80621770-80621792 CAGACTAACAACAGACATCTTGG - Intergenic
1193399774 X:81028607-81028629 CAGACTAACAGCAGATCTCTCGG + Intergenic
1193402772 X:81065428-81065450 CAGACTAACAGCAGATCTCTCGG + Intergenic
1193441361 X:81543589-81543611 CAGAATAACAGCAATTTTCAGGG + Intergenic
1193621005 X:83752267-83752289 CAGACTAACAGCAGATCTCTCGG + Intergenic
1193731808 X:85111032-85111054 CAGAAGAAAACAAAATAACTGGG - Intergenic
1193733689 X:85132007-85132029 CAGACTAACAGCAGATCTCTCGG - Intergenic
1193896270 X:87117954-87117976 CAGACTAACAGCAGATCTCTCGG + Intergenic
1194266049 X:91754443-91754465 CAGACTAACAGCAGATCTCTCGG + Intergenic
1194438421 X:93898209-93898231 CAGCTTAATACCAAATATTTAGG - Intergenic
1194441722 X:93941517-93941539 CAGAATAACAGCTGATCTCTCGG + Intergenic
1194508898 X:94767932-94767954 CAGACTAACAGCAGATCTCTTGG - Intergenic
1194570341 X:95548243-95548265 CAGACTAACAGCAGATCTCTCGG - Intergenic
1194803726 X:98301984-98302006 CAGACTAACAGCAGATCTCTCGG + Intergenic
1194808641 X:98362904-98362926 CAGAATAAAACCCAGTTTCTTGG - Intergenic
1195067282 X:101248998-101249020 CACAATAATACCCAATATCTGGG + Intronic
1195099650 X:101541982-101542004 CAGACTAACAGCGAATCTCTCGG + Intergenic
1195117565 X:101715438-101715460 CAGACTAACAGCAGATCTCTCGG - Intergenic
1195125922 X:101810046-101810068 CAGACTAACAGCAGATCTCTTGG - Intergenic
1195628128 X:107025102-107025124 TAGAATAACATAAAATACCTAGG - Intergenic
1195854788 X:109319270-109319292 CAGACTAACAGCAGATCTCTTGG - Intergenic
1196041525 X:111210037-111210059 CATAATAACTCTAAATATCTTGG - Intronic
1196146890 X:112327789-112327811 CAGACTAACAGCAAATCTCTTGG + Intergenic
1196252744 X:113481038-113481060 CAGACTAACAGCAGATCTCTCGG + Intergenic
1196435795 X:115673370-115673392 CAGACTAACAGCAGATCTCTTGG + Intergenic
1196638658 X:118033375-118033397 CAGACTAACAGCAGATCTCTCGG + Intronic
1197298996 X:124755847-124755869 CAGACTAACAGCAGATCTCTCGG - Intronic
1197369842 X:125613308-125613330 CAGACTAACAGCAGATCTCTCGG - Intergenic
1197389304 X:125840632-125840654 CAGACTAACAGCAGATCTCTCGG + Intergenic
1197417172 X:126189582-126189604 CAGACTAACAGCAGATCTCTCGG - Intergenic
1197619778 X:128734513-128734535 CAGACTAACAGCAGATCTCTCGG + Intergenic
1197649190 X:129046013-129046035 CAGACTAACAGCAGATCTCTCGG + Intergenic
1197676814 X:129338688-129338710 CAGACTAACAGCAGATCTCTCGG + Intergenic
1197736959 X:129858006-129858028 CAGACTAACAGCAGATCTCTCGG - Intergenic
1197877592 X:131127573-131127595 CAGACTAACAGCAGATCTCTCGG - Intergenic
1197879966 X:131156626-131156648 CAGACTAACAGCAGATCTCTTGG - Intergenic
1197880574 X:131162767-131162789 CAGACTAACAGCAGATCTCTCGG - Intergenic
1197909343 X:131463361-131463383 CAGACTAACAGCAGATCTCTTGG + Intergenic
1197915163 X:131526247-131526269 CAGACTAACAACAGATCTCTCGG + Intergenic
1197917784 X:131554464-131554486 CAGACTAACAGCAGATCTCTTGG + Intergenic
1198138474 X:133778806-133778828 CAACATAACCCCAAATGTCTTGG - Intronic
1198571463 X:137961448-137961470 CAGACTAACAGCAGATCTCTCGG + Intergenic
1198712972 X:139525319-139525341 CAGAATAACAGCTGATCTCTCGG + Intergenic
1199340169 X:146668287-146668309 CAGGTTAGCACCAAATATCCTGG + Intergenic
1199578303 X:149335645-149335667 CAGACTAACAGCAGATCTCTTGG + Intergenic
1199933264 X:152546166-152546188 CAGACTAACAGCAGATCTCTCGG + Intergenic
1200378636 X:155810567-155810589 CAGACTAACAGCAGATCTCTTGG + Intergenic
1200583210 Y:4975013-4975035 CAGACTAACAGCAGATCTCTCGG + Intergenic
1200741076 Y:6854073-6854095 CAGACTAACATCAGATCTCTCGG + Intergenic
1200751806 Y:6953035-6953057 CAGACTAACATCAGATCTCTTGG - Intronic
1200805546 Y:7429532-7429554 CAGACTAACAGCAGATCTCTTGG + Intergenic
1200874446 Y:8138678-8138700 CAGACTAACAGCAGATCTCTCGG - Intergenic
1201186235 Y:11405937-11405959 CAGACTAACAGCAGATCTCTTGG + Intergenic
1201308420 Y:12571335-12571357 CAGACTAACAGCAGATGTCTTGG + Intergenic
1201314278 Y:12628408-12628430 CAGACTAACAGCAGATCTCTTGG - Intergenic
1201364436 Y:13187816-13187838 CAGACTAACAGCAGATCTCTTGG + Intergenic
1201415468 Y:13745076-13745098 CAGACTAACAGCAGATCTCTCGG - Intergenic
1201419321 Y:13781189-13781211 CAGACTAACAGCAGATCTCTTGG - Intergenic
1201431904 Y:13911037-13911059 CAGACTAACAGCAGATCTCTCGG + Intergenic
1201466239 Y:14283929-14283951 CAGATTAACAGCAGATCTCTTGG + Intergenic
1201572356 Y:15427691-15427713 CAGACTAACATCAGATATCTTGG + Intergenic
1201619918 Y:15945325-15945347 CAGATTAACAGCAGATCTCTCGG - Intergenic
1201908878 Y:19113275-19113297 CAGACTAACAGCAGATTTCTCGG - Intergenic
1201971608 Y:19803353-19803375 CAGACTAACAGCAGATCTCTTGG + Intergenic
1202041863 Y:20694240-20694262 CAGACTACCAGCAGATATCTTGG - Intergenic
1202055430 Y:20825357-20825379 CAGACTAACAGCAGATCTCTCGG - Intergenic
1202058037 Y:20856416-20856438 CAGACTAACAGCAGATCTCTCGG - Intergenic
1202333234 Y:23777367-23777389 CAGACTAACAGCAGATTTCTTGG - Intergenic
1202333459 Y:23779913-23779935 CAGACTAACAGCAGATCTCTTGG - Intergenic
1202537310 Y:25890150-25890172 CAGACTAACAGCAGATCTCTTGG + Intergenic
1202537535 Y:25892696-25892718 CAGACTAACAGCAGATTTCTTGG + Intergenic
1202602085 Y:26603546-26603568 CAGACTAACAGCAGATCTCTTGG + Intergenic