ID: 1171222268

View in Genome Browser
Species Human (GRCh38)
Location 20:23409758-23409780
Sequence CTGTAGGCACGGATTATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171222268_1171222275 23 Left 1171222268 20:23409758-23409780 CCACCCATAATCCGTGCCTACAG 0: 1
1: 0
2: 1
3: 4
4: 59
Right 1171222275 20:23409804-23409826 GCCTCCATTAAATATAATTTAGG 0: 1
1: 0
2: 1
3: 12
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171222268 Original CRISPR CTGTAGGCACGGATTATGGG TGG (reversed) Intronic
901358333 1:8672429-8672451 CTGTAGCCCAGGATTTTGGGAGG - Intronic
903640403 1:24855868-24855890 CAGGAGGCAAGGATTTTGGGGGG + Intergenic
905293983 1:36942658-36942680 CTGTAGGCAAGGGTTGGGGGTGG - Intronic
905870930 1:41404304-41404326 CTGTAGGCAGGGATCCTGGTTGG - Intergenic
909556413 1:76959147-76959169 TTGTAGACAGGGGTTATGGGTGG + Intronic
914840752 1:151246630-151246652 CAGGAGGCAGGGATTATTGGGGG + Intronic
914959177 1:152191029-152191051 CTGTAGGTACAGATTATCAGTGG - Intergenic
924385844 1:243497324-243497346 CTGTAGGCACGGGTGGGGGGGGG + Intronic
1065345754 10:24746499-24746521 CTGCAGACACGGATTTTAGGAGG - Intergenic
1066455070 10:35565512-35565534 CAAAAGGCAGGGATTATGGGGGG - Intronic
1069497743 10:68921588-68921610 CTGATGGCACTGATTATTGGTGG - Intronic
1089283872 11:117393277-117393299 CTGTGGTCAGGGATTGTGGGAGG + Intronic
1101801025 12:108022049-108022071 CTGCATGCATGGATGATGGGTGG - Intergenic
1104321876 12:127759274-127759296 CTGGAGGCAGGTATTATGGTTGG - Intergenic
1107985829 13:45775481-45775503 CTGTAGGCAAGGCTTACGTGGGG + Intergenic
1109283911 13:60389265-60389287 ATGTAAGCAGGGATTAAGGGAGG - Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1115162627 14:30413183-30413205 CTGGGGGCACGGATTAGGGATGG - Intergenic
1119578339 14:75750184-75750206 CTGTAGGCACAGGTTATGAGAGG + Intronic
1125611864 15:40976786-40976808 CTGTAGGCAGGGATTCTGTGAGG + Intergenic
1127892291 15:63264583-63264605 TTGTAGACAGGGATTATGGTAGG - Exonic
1128958652 15:71976059-71976081 CTGGAGGCATGGATTACAGGCGG + Intronic
1129717082 15:77858807-77858829 CTGTGGGCATGGATGAGGGGAGG - Intergenic
1143398962 17:6628238-6628260 CTGAAGTCCCGGATCATGGGTGG + Exonic
1146419167 17:32666186-32666208 CTGTAGGTAGGGATGAGGGGTGG - Intronic
1146623642 17:34419537-34419559 CTGAAGACTGGGATTATGGGAGG + Intergenic
1147417857 17:40306695-40306717 CTGTAGGCAAGGGTTTAGGGAGG + Intergenic
1150842630 17:68623048-68623070 CTGGAGGCAGAGAGTATGGGTGG - Intergenic
933076895 2:77940117-77940139 CTGGAGGCAGGGATTATCTGGGG + Intergenic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168858467 20:1027801-1027823 CCGTGGGCACGGTATATGGGAGG - Intergenic
1169039576 20:2482038-2482060 CTGTGGGCAGGGCTTGTGGGTGG - Exonic
1171222268 20:23409758-23409780 CTGTAGGCACGGATTATGGGTGG - Intronic
1172165047 20:32893832-32893854 CAGTAGGGGCGGATTATGGGAGG - Intronic
1180622434 22:17171288-17171310 CTGTAGTCCCGCATTCTGGGAGG - Intergenic
949202622 3:1397107-1397129 CTCTAGGCATGGCTCATGGGAGG - Intronic
950871306 3:16231927-16231949 CTCTAGGCACAGATCAAGGGTGG + Intronic
951774781 3:26297723-26297745 CAGAAGGCAAGGATTATTGGGGG - Intergenic
954916344 3:54151287-54151309 ATGTAGGGACGGATAATGGATGG + Intronic
955379162 3:58422769-58422791 CTCCAGGCAAGGATTTTGGGGGG - Intronic
957919879 3:86733345-86733367 CAGCAGGCACGGAGTGTGGGCGG + Intergenic
960199113 3:114810535-114810557 CTGTGGGGACGGATAATAGGAGG + Intronic
963403257 3:144828938-144828960 CTGTAGACATTAATTATGGGTGG + Intergenic
967302151 3:188024904-188024926 CTGAAGGTTGGGATTATGGGTGG + Intergenic
973895363 4:55407073-55407095 CTGTGGGCAATGAGTATGGGAGG - Intronic
976432462 4:84978685-84978707 CAGGAGGCAAGGGTTATGGGGGG - Intergenic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
988099548 5:26659503-26659525 CTGTAGCCAAGGAATATAGGTGG + Intergenic
996015151 5:118525563-118525585 CTGTAGTCACAGTTTCTGGGGGG - Intergenic
996968220 5:129331162-129331184 GTGTAGCCTTGGATTATGGGAGG - Intergenic
997631027 5:135369160-135369182 CTGTAGGCAAGGGGGATGGGTGG - Intronic
1001789515 5:174443881-174443903 GTGGAGGCACGGAGTAAGGGAGG - Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1016439983 6:144073641-144073663 CTGTAGCAAGGGCTTATGGGAGG - Intergenic
1017917720 6:158845421-158845443 CTGTAGTCCCAGACTATGGGAGG - Intergenic
1018183837 6:161247724-161247746 CTGTAATCACAGATTTTGGGAGG + Intronic
1018331499 6:162732512-162732534 CTGTAGCCAAGGAATATTGGGGG + Intronic
1019931138 7:4224073-4224095 CTGGAGGCATGGATTATGGGTGG - Intronic
1020130670 7:5556896-5556918 CTGCAGGAACGGGTTCTGGGTGG - Intronic
1039793854 8:40896133-40896155 CTGTAGGCAGCTATTTTGGGTGG - Intronic
1040582748 8:48710641-48710663 CTGAATGCATGGATTATGGTAGG - Intergenic
1044151106 8:88775571-88775593 CTGTAGATACAGATTAAGGGTGG - Intergenic
1049446497 8:142633899-142633921 CTGCAGGGACGGATGCTGGGAGG - Intergenic
1191695511 X:63985848-63985870 CTGCAGGCAGGGATTGTTGGGGG - Intergenic